ID: 1065544539

View in Genome Browser
Species Human (GRCh38)
Location 10:26806174-26806196
Sequence AAGCAGATATTCTTGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065544539 Original CRISPR AAGCAGATATTCTTGGGGCA AGG (reversed) Intronic
902564617 1:17303120-17303142 AAGGAGAGATGCTGGGGGCAGGG + Intergenic
903495196 1:23761591-23761613 ATGTAGATACTCTTGGGGGAGGG - Exonic
904842786 1:33384228-33384250 AATCAGAAATTCTGGGAGCAGGG + Intronic
905761970 1:40566389-40566411 AAGCACAGATTGTTAGGGCAGGG + Intergenic
907562399 1:55402946-55402968 AAGGAGATATTCTTGGGAATGGG + Intergenic
907614167 1:55907044-55907066 ATGCAGATACTCTTAGAGCAGGG + Intergenic
907856123 1:58305718-58305740 AAACAGAGATGCTTGGGGAATGG - Intronic
911159521 1:94670809-94670831 GAGCAGATACTCCTGAGGCAAGG - Intergenic
913283067 1:117203838-117203860 AATCAGAAATTCTGGGGGCAGGG - Intronic
913705163 1:121413700-121413722 AAGCTGATGTGGTTGGGGCAAGG + Intergenic
916001337 1:160619196-160619218 AAGCAGATATGCTTGAAGGAAGG - Intronic
916741871 1:167653342-167653364 AAGCAGATTTTGTGGAGGCAAGG - Intronic
921214938 1:212928689-212928711 AAGCAGTTAAGCTGGGGGCATGG - Intergenic
923504529 1:234594070-234594092 AAGCAGTTCTCCTTGTGGCAGGG - Intergenic
923848833 1:237770015-237770037 TAACAAATATTTTTGGGGCAAGG - Intronic
1063586563 10:7358106-7358128 ATGCAGATGTTCTAGGGCCATGG - Intronic
1064574635 10:16731886-16731908 AAGCCGATATTGTTGGGACAGGG + Intronic
1065544539 10:26806174-26806196 AAGCAGATATTCTTGGGGCAAGG - Intronic
1066546010 10:36501485-36501507 AAGCAGATATATAAGGGGCAAGG - Intergenic
1067147351 10:43703135-43703157 AAGCAGAGCTTCTTGGGCCCAGG - Intergenic
1069166736 10:65169497-65169519 AAGTAGACATGCTAGGGGCAGGG - Intergenic
1069602420 10:69716610-69716632 AAGCAGAGATTCTGGAGGTAGGG - Intergenic
1070717336 10:78732314-78732336 AAGGAGTTAGTCTTGGGGCAAGG + Intergenic
1071965595 10:90848900-90848922 AATCAGAAACTCTTGGGGTAAGG + Intronic
1072903929 10:99433306-99433328 GAGCAGATATTGTGGGGACATGG - Intergenic
1074345416 10:112680728-112680750 AAGAAGAAATTCCTGGGGCCTGG + Intronic
1075685645 10:124363647-124363669 AAGCAGGTATTCTTGGGAGGAGG + Intergenic
1080919662 11:36696378-36696400 GAGCAGATATTCTAGGCACAGGG + Intergenic
1081412809 11:42779931-42779953 AATCAGAAATTCTGGGGACAGGG + Intergenic
1083118625 11:60490144-60490166 GACCAGAGATCCTTGGGGCAGGG - Intergenic
1083592574 11:63904200-63904222 AAGAAGAAATTGTTGGGGCAAGG - Intronic
1086899487 11:92350419-92350441 AAAAAGATATGCTGGGGGCAGGG + Intergenic
1088317023 11:108518016-108518038 AAGCAAATATTCTTGAATCATGG - Intronic
1089586141 11:119511030-119511052 AAGCAGGTATTTTTGGGGGTGGG + Intergenic
1089998542 11:122931988-122932010 AAGCAGTTATTCTAAGTGCATGG + Intronic
1090250425 11:125247112-125247134 AAGCAGAAACTGTTGGGGCCTGG - Intronic
1095242933 12:39882256-39882278 AATCAGAAATTCTGGGGACAGGG - Intronic
1095514512 12:42991125-42991147 ATGCTGATACTCTTAGGGCAGGG + Intergenic
1095693972 12:45123188-45123210 AGGCAAATTTTCTCGGGGCAAGG + Intergenic
1096555302 12:52400139-52400161 AGGCAGATCTCCTGGGGGCAGGG + Exonic
1096772037 12:53941313-53941335 CAGCAGGAATTCCTGGGGCAGGG + Intronic
1097112188 12:56668900-56668922 AATCATTTATTCTTGGGCCATGG + Intronic
1097451829 12:59745668-59745690 AAGCAGATATTCTTCCTGGAAGG + Intronic
1097916272 12:65023458-65023480 AAGCAGATACTCCTGGTGAATGG - Intergenic
1098751510 12:74298305-74298327 GGGCAGATGTTGTTGGGGCAGGG - Intergenic
1102629298 12:114263348-114263370 AAGCAGATATGCCTGGGGAGTGG + Intergenic
1103334729 12:120180691-120180713 AAACAGATATGCTTGTGGCCGGG + Intronic
1103363127 12:120365705-120365727 ATGCAGCTAGGCTTGGGGCAAGG + Intronic
1104089024 12:125499135-125499157 CAGCAGATATGCTTTGGGGATGG - Intronic
1106951148 13:34885299-34885321 AAACAGATATCCATGGAGCATGG + Intergenic
1107818414 13:44264991-44265013 AAGAAGATATTTTTGGGACTGGG - Intergenic
1108262048 13:48668108-48668130 AATCAGATTTTCATGGGGAATGG - Intronic
1110449031 13:75619948-75619970 AAGAAAATATTTTTGGGGCCGGG - Intergenic
1111285150 13:86081367-86081389 AAGCAGAGATTGTTGGGGATGGG + Intergenic
1111583538 13:90254910-90254932 AAGCAGATATTACTGATGCATGG + Intergenic
1111761041 13:92464602-92464624 ATGCAGGTATTCTTGAGTCAAGG - Intronic
1111850555 13:93567953-93567975 AAGTTGCTATTCTTGGGTCATGG - Intronic
1112195865 13:97225698-97225720 AAGCACAGATCCCTGGGGCATGG + Intronic
1114429767 14:22650766-22650788 AAGCAGATATTCTGAGGGGTGGG - Intergenic
1114675152 14:24435422-24435444 AAGCATGCTTTCTTGGGGCAGGG + Intronic
1115226306 14:31105628-31105650 AACCATATATTCTTGAGGAAGGG + Exonic
1115378425 14:32705260-32705282 ATGCAGATATTCTGTGGGGAAGG + Intronic
1117047410 14:51827381-51827403 AACCAGAAATTCTGGGAGCAGGG + Intronic
1117914534 14:60663440-60663462 AATCAGAAACTCTTGGGGCAGGG - Intergenic
1118159127 14:63271523-63271545 AAGCAGAAATTCTTGGAGTGGGG - Intronic
1118896717 14:69951437-69951459 AAGCAGATTTTCTTGGTGAAGGG - Intronic
1119231743 14:72985309-72985331 AAACAAAAATTATTGGGGCATGG - Intronic
1120703059 14:87719515-87719537 AAGCATATAGTCTTGGCACATGG - Intergenic
1121357934 14:93230959-93230981 ATGGAGATATTCTGGGGACAGGG + Intergenic
1125206217 15:37156025-37156047 AAGAATATATTCTGTGGGCATGG + Intergenic
1126196494 15:45937379-45937401 AAGCAGACATTCTTGGGGACGGG - Intergenic
1126216813 15:46164833-46164855 ATGCAGATACCCTTGGGTCATGG - Intergenic
1129331566 15:74830484-74830506 CAGAAGATAGGCTTGGGGCATGG - Exonic
1129336640 15:74856013-74856035 GAGGAGCTCTTCTTGGGGCAGGG - Intronic
1129819635 15:78589626-78589648 AGGAAGATATTCCTGGAGCAGGG + Intronic
1132925452 16:2426988-2427010 AATCAGAAATGCCTGGGGCAGGG + Intergenic
1134598134 16:15512159-15512181 AAGCAGATAATTTTGGCACATGG + Intronic
1134914327 16:18057235-18057257 AAGCAGATTTTTTTGGGGGGGGG - Intergenic
1146153096 17:30494576-30494598 AGGCAGAAATTCTTGGGGTGGGG - Intronic
1147545969 17:41402133-41402155 AAGGAGATATTTTTGGGGGAAGG - Intergenic
1148499166 17:48076277-48076299 AAGCTGAAATTCTTGGGGAATGG + Intronic
1151281626 17:73079423-73079445 ATGCAGATATTTTTATGGCAGGG - Intronic
1152331885 17:79678297-79678319 GAGCAGCCATTCCTGGGGCACGG - Intergenic
1152661296 17:81543519-81543541 AAGCAGCTATTCCTGTGCCAGGG + Intronic
1155439832 18:25850766-25850788 AAGAAGACATTCTTGAGGTATGG + Intergenic
1155760583 18:29560383-29560405 AAGCAGTTATTCTTTGCTCAGGG - Intergenic
1158622086 18:59041453-59041475 AATCAGACTTTCTGGGGGCATGG + Intergenic
1158664270 18:59418343-59418365 AAGCTGATATTAATGGGGCCTGG + Intergenic
1159019589 18:63132381-63132403 CAGCAGAACTTCTTGGGGGAAGG - Intronic
1161324379 19:3656295-3656317 AAGCAGGCATCCTTGGGGCGTGG - Intronic
1161491801 19:4566480-4566502 AAGCAGATGGTCTTGGGGATAGG - Intergenic
1165393312 19:35550489-35550511 AAGCAGATACTGGTGGGGCTGGG + Exonic
925991889 2:9260864-9260886 AAGCAGATAGAGTAGGGGCAGGG - Intronic
926053431 2:9759217-9759239 ATGCAGAAATTCCTGGGTCAGGG + Intergenic
926714788 2:15915619-15915641 AAACAGACATTTTTGGGGCCAGG + Intergenic
926925161 2:17980076-17980098 AAGCAGAAAGTCTTAGGGCCAGG + Intronic
929332755 2:40703831-40703853 AAGCATATATTCTAGGGTGAAGG + Intergenic
930258114 2:49114784-49114806 AAGCAGAAATTGTTGGGGGAGGG + Intronic
932904766 2:75738123-75738145 AAGCAGATCTGATTTGGGCAGGG - Intergenic
932971818 2:76552428-76552450 AATCAGAGATTCTTAGGGCGTGG - Intergenic
933616858 2:84490853-84490875 AATCATATATTCATGGGCCAGGG - Intergenic
935452542 2:103226615-103226637 AAGCTGATATTCTGAGGGGAGGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
938275030 2:130011848-130011870 AAACAGATATACATGGGACATGG + Intergenic
938325990 2:130402573-130402595 AAACAGATATACATGGGACATGG + Intergenic
938363953 2:130718893-130718915 AAACAGATATACATGGGACATGG - Intergenic
938645133 2:133322851-133322873 AATCAGAAATTCTTGGGGGTGGG - Intronic
939263867 2:139846676-139846698 AATCAGAAATTCTGGGGGTAGGG - Intergenic
941585989 2:167360004-167360026 AAGCAGATATACATGGTACATGG - Intergenic
942403836 2:175631751-175631773 AAGCAGAAATTCTTTGTGAAAGG + Intergenic
942475227 2:176312377-176312399 AACCATATATTCTTGGGGGATGG + Intronic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
943748004 2:191482551-191482573 AAGCAAATATTCTGGGTGCTGGG + Intergenic
943862081 2:192879707-192879729 AAGCAGAGATTCTTGGAAAAAGG - Intergenic
947171225 2:227313930-227313952 AATCAGAAACTCTTGGGGGAGGG + Exonic
1169765974 20:9148532-9148554 CAGGAGAAATTCTTGGGGCGAGG - Intronic
1170170382 20:13404281-13404303 AATAAGATCTTCTTGGGCCAAGG - Intronic
1170464078 20:16607034-16607056 ATGCAAATATTCTTGGAACAAGG + Intergenic
1173310878 20:41895008-41895030 AGGCAGAGATTCCTGGGGCTGGG + Intergenic
1173963014 20:47089530-47089552 AAGCAGGTAGTCCTGGGGCCAGG + Intronic
1174203879 20:48825998-48826020 AAGGAGATGTACTGGGGGCAGGG - Intronic
1175488845 20:59365110-59365132 ATGCAGTTATTCTGGGGCCATGG + Intergenic
1176886712 21:14265255-14265277 AAGGACAGATTCATGGGGCATGG + Intergenic
1177558820 21:22724498-22724520 AATAAGATATTTTTGGGGGAAGG + Intergenic
1178112371 21:29381607-29381629 AATCAGAAACTCTAGGGGCACGG - Intronic
1183092127 22:35529693-35529715 AGGCAGGTATTCATGGGGCTGGG + Intergenic
1185125294 22:49007149-49007171 AAGCAGACAGCCGTGGGGCAGGG + Intergenic
950146711 3:10655323-10655345 AAGCTGCTGTTCTTGGTGCAGGG - Intronic
953535916 3:43776622-43776644 AAAGAAATATTCTTGGGGCCAGG + Intergenic
953701328 3:45198271-45198293 AAGCAGATGTGCTTGGGCCCAGG - Intergenic
956915131 3:73862766-73862788 AAGGAGATATGCTTTGGGAAAGG + Intergenic
957687618 3:83523019-83523041 TAGCAGCTATGCTTGGGGCTGGG - Intergenic
957758788 3:84527289-84527311 AAGCTAAAATTCTTGGTGCATGG + Intergenic
958682889 3:97353564-97353586 AAGAAGTTTTTCTTGGGGCTTGG + Intronic
958704664 3:97640468-97640490 TAGAAGATATTATTGGGGCCGGG + Intronic
960051160 3:113240863-113240885 CAGCAGATATACTTGTGACAAGG + Intronic
960333307 3:116389142-116389164 AAGCAGATTGTCTTGGCCCAAGG - Intronic
961041992 3:123684036-123684058 AAGCAGAAAGCCATGGGGCAGGG + Intronic
961426651 3:126853629-126853651 AAGCAGGTGTTGATGGGGCAAGG - Intronic
962372383 3:134831386-134831408 CAGCAGATACTCTCGGGCCATGG + Intronic
962470081 3:135699044-135699066 AAGGAGATGTTCTTGAGGCAGGG + Intergenic
962567487 3:136677038-136677060 AAGGAGATATTCTAGAGGGAAGG - Intronic
962760935 3:138513282-138513304 ATGCAGAAATGCTTGTGGCAAGG - Intronic
963006128 3:140727620-140727642 AAACAGTGATTCTTGGGGCCAGG - Intergenic
963450325 3:145472351-145472373 AAGCAGATATTCTAGTGCAATGG - Intergenic
965549991 3:169954748-169954770 AAGCAGACATTCTAGGGGTAGGG - Intergenic
966625288 3:182009197-182009219 AAGCAGATTTTAATGGGGGATGG + Intergenic
967046427 3:185741518-185741540 TAGCAGTTATTCATGGGACAGGG - Intronic
967546029 3:190729554-190729576 AGTCAGATATTTTGGGGGCAGGG - Intergenic
970062720 4:12052997-12053019 AATCATATATTTTTGGGCCATGG + Intergenic
971419287 4:26460841-26460863 AAGCAGAACTTCTGGGGGAAAGG - Intergenic
972066012 4:34945172-34945194 AAGAAGATAGTCTTGGGGACTGG - Intergenic
972174940 4:36392153-36392175 AAGCAGATTCTCTTCTGGCAAGG + Intergenic
972184692 4:36514308-36514330 AAACAGATATTCTTGGGGGCAGG - Intergenic
972629381 4:40830001-40830023 AAGCGGATTTTCCAGGGGCAGGG - Intronic
973691479 4:53437615-53437637 AATCAGAAATTCTAGGGGAAGGG + Intronic
975425196 4:74217092-74217114 AAGCAGATATGGCTAGGGCAGGG - Intronic
976715811 4:88121561-88121583 TCCCAGATATTCTTGGGGCAGGG - Intronic
976734650 4:88297201-88297223 AAGCTCATATTCAAGGGGCAAGG - Intergenic
976843131 4:89455499-89455521 AAGTAAATATTCTTGGGGAGTGG - Intergenic
977177137 4:93831241-93831263 TTGCAGATGTTGTTGGGGCAAGG - Intergenic
977793193 4:101131079-101131101 ACGCAAATATTAGTGGGGCATGG + Intronic
978552499 4:109942589-109942611 AAGCTGGTCTTCTTGGGGAATGG - Intronic
980995643 4:139777379-139777401 ATTCAGATCTTCTTGTGGCAAGG - Intronic
981024414 4:140062409-140062431 AATCAGATATTCTTGGGGCAGGG + Intronic
981227659 4:142315560-142315582 AAGCAGAATATCTGGGGGCATGG - Intronic
981652603 4:147076616-147076638 AAGCCTATATTTTTGTGGCATGG + Intergenic
983928839 4:173431670-173431692 GGGCAGACATTCCTGGGGCAGGG - Intergenic
984167890 4:176324581-176324603 ATGCAGATATTCTGGAGGAAAGG + Intronic
987914780 5:24198498-24198520 TAGCAAATACTCTTGTGGCAGGG - Intergenic
987925249 5:24332727-24332749 AAGCAGATGTTCTTTAGACAAGG + Intergenic
989973613 5:50555197-50555219 AAGCTGATGTGGTTGGGGCAAGG - Intergenic
990011650 5:51005896-51005918 AAATAGATTTTCTTGGGGGAGGG - Intergenic
990479625 5:56196959-56196981 AATCAGATACTCTAGGAGCAGGG + Intronic
991025882 5:62029100-62029122 AAGCAATTATTCTTGGGGATGGG - Intergenic
991266390 5:64724152-64724174 AAATAGCTATACTTGGGGCATGG + Exonic
991434834 5:66587210-66587232 AAGCTATTATTGTTGGGGCAGGG - Intergenic
991993356 5:72363312-72363334 AATCAGATATTCTGGGGGTGGGG - Intergenic
994003641 5:94811605-94811627 AAGTACAAATTCTTGGAGCAAGG + Intronic
1000412626 5:160949418-160949440 CAGCAGATACTCTGGGGGCTGGG + Intergenic
1003369197 6:5508499-5508521 CAGGAGATCTTCTTGGGGAAAGG + Intronic
1004813227 6:19283280-19283302 AAGCAGAGATTCTGGGAGTAGGG + Intergenic
1005309742 6:24548132-24548154 AAGCACATATACTTATGGCAGGG + Intronic
1005454973 6:26010853-26010875 AAACATATCTTCTGGGGGCAAGG + Intergenic
1005621469 6:27624327-27624349 GACCTGACATTCTTGGGGCAGGG + Intergenic
1008557642 6:52689889-52689911 AAATAGCTATACTTGGGGCATGG - Intergenic
1008904335 6:56659559-56659581 AAACACTTATTCTTGGGTCATGG - Intronic
1010340775 6:74749829-74749851 ATGCAGATATTTTGGGTGCAAGG - Intergenic
1010426405 6:75733261-75733283 AAGTAGGTATTTTTTGGGCAGGG - Intergenic
1012812240 6:103973805-103973827 AAACAAAAATTCTTGGGTCATGG - Intergenic
1012928733 6:105294802-105294824 AAGCAGATATTCCAGGGGTAAGG - Intronic
1013384577 6:109612523-109612545 GAGCAGACAGTCTTGGGGCAGGG + Intronic
1013574831 6:111471851-111471873 AAGGAGATAATCTTTGGGAATGG + Intronic
1014934705 6:127374110-127374132 AAGCAGATGATTTTGGGGGAAGG - Intergenic
1017800198 6:157888763-157888785 CAGGAGCTCTTCTTGGGGCATGG + Intronic
1019079611 6:169421494-169421516 AAGCAGACATTTTGGGGGCACGG - Intergenic
1019107943 6:169684345-169684367 AAGTATTTCTTCTTGGGGCAGGG - Intronic
1020353217 7:7246655-7246677 AATCAGATACTCTAGGGGCAGGG + Exonic
1021911332 7:25388361-25388383 AATCACATATTCTTGGTGAAGGG - Intergenic
1022555923 7:31295894-31295916 AATCAAAAATTCTGGGGGCAGGG + Intergenic
1022568470 7:31427522-31427544 AATCAGAATTTCTTGGAGCAGGG + Intergenic
1022602491 7:31774936-31774958 AAGCACATCTGTTTGGGGCAAGG - Intronic
1027689884 7:81331259-81331281 TAGCAGACATTCTTGAGGAAAGG - Intergenic
1028123169 7:87080342-87080364 AAGAAGATATTCCTGGGAGAAGG + Intergenic
1028602271 7:92615247-92615269 AGGCAGATATTCTTTTGGCTGGG + Exonic
1030428173 7:109406982-109407004 AAGCAGATATTCTTGATGGGGGG + Intergenic
1031614099 7:123860735-123860757 AAGCAGAATTTCTTGGTGAAAGG + Intronic
1034221497 7:149449960-149449982 AAGCAGATGTTCTAGGAACATGG - Intronic
1036072000 8:5451068-5451090 AAACAGAGATTCTTGGGATAAGG + Intergenic
1038770341 8:30473200-30473222 AAGAAAACATTCTTGGGGAAGGG - Intronic
1038772246 8:30493903-30493925 AAGCAGATTCTCCTAGGGCATGG + Intronic
1040567963 8:48583306-48583328 AAGCTGAGATTCTTGGGCCATGG + Intergenic
1042421412 8:68594236-68594258 ATGCAGATATCCATGGGCCAAGG - Intronic
1044941075 8:97344560-97344582 AACCAGAATTTCTGGGGGCAGGG - Intergenic
1046038114 8:108868546-108868568 AAGCTCATCTTCTTGGGCCATGG - Intergenic
1046690979 8:117283887-117283909 AAGCAGAAATTGTTGGGTCCAGG + Intergenic
1047613233 8:126541189-126541211 AATCACAAATTCTAGGGGCAGGG - Intergenic
1048370204 8:133770530-133770552 AAACAGATATACATGGTGCATGG - Intergenic
1048968527 8:139630889-139630911 AAGCAGACTTACTTGGGGGATGG - Intronic
1049102331 8:140588681-140588703 AAGCATACATTCTTTGTGCAGGG + Intronic
1050865981 9:10499926-10499948 AAGCAGAGATTCCTGGAGGATGG + Intronic
1051675553 9:19554756-19554778 CAGAAGATAATCTTGGGCCATGG + Intronic
1055873435 9:80914185-80914207 AATCAGAAACTCTGGGGGCAGGG + Intergenic
1058286073 9:103180093-103180115 AATCAGCTATTCCTGGGTCATGG + Intergenic
1060216322 9:121740608-121740630 CAGCAAAAAGTCTTGGGGCAGGG - Intronic
1203462056 Un_GL000220v1:50330-50352 AAGCAGATTTTCACAGGGCATGG + Intergenic
1186708998 X:12173293-12173315 CAGCAGATACATTTGGGGCATGG + Intronic
1188637385 X:32451211-32451233 AATCAGAAATTCTGGGGTCAGGG + Intronic
1189445877 X:41081050-41081072 TATCAGATATTTCTGGGGCAGGG + Intergenic
1191847798 X:65561545-65561567 ACACAGATATTCAGGGGGCATGG + Intergenic
1192699975 X:73458426-73458448 AAGCAGATATTCATGTGGTATGG + Intergenic
1193427461 X:81356749-81356771 AGGCAGATATTCTGAGGACAGGG + Intergenic
1194202261 X:90967387-90967409 AACCAGAATTTCTTGGAGCAAGG - Intergenic
1195091102 X:101459953-101459975 AATCAGAAACTCTAGGGGCAGGG - Intronic
1196275042 X:113756799-113756821 ATGGAGATATTCTGGGAGCATGG + Intergenic
1196465702 X:115969553-115969575 CAGCAGGTAGTCTTGGGGTAGGG + Intergenic
1196964657 X:121042489-121042511 AGGCAGAGATTCCTTGGGCAGGG + Intergenic
1197028964 X:121790459-121790481 AAGCAGATTATATTGGGGCCAGG - Intergenic
1200548097 Y:4542841-4542863 AAACAGAATTTCTTGGAGCAAGG - Intergenic
1201628323 Y:16039776-16039798 CAGCAGATATTGGTGAGGCAGGG - Intergenic