ID: 1065546290 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:26825012-26825034 |
Sequence | GAGTCCTAATATTTGTGTGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065546288_1065546290 | -3 | Left | 1065546288 | 10:26824992-26825014 | CCATCTTCAGAGCCTTCAGAGAG | No data | ||
Right | 1065546290 | 10:26825012-26825034 | GAGTCCTAATATTTGTGTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065546290 | Original CRISPR | GAGTCCTAATATTTGTGTGC TGG | Intronic | ||
No off target data available for this crispr |