ID: 1065546290

View in Genome Browser
Species Human (GRCh38)
Location 10:26825012-26825034
Sequence GAGTCCTAATATTTGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065546288_1065546290 -3 Left 1065546288 10:26824992-26825014 CCATCTTCAGAGCCTTCAGAGAG No data
Right 1065546290 10:26825012-26825034 GAGTCCTAATATTTGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065546290 Original CRISPR GAGTCCTAATATTTGTGTGC TGG Intronic
No off target data available for this crispr