ID: 1065548474

View in Genome Browser
Species Human (GRCh38)
Location 10:26846185-26846207
Sequence GGTGGCTAGTCTAGAGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065548474 Original CRISPR GGTGGCTAGTCTAGAGGTGA TGG (reversed) Intronic
900507022 1:3034815-3034837 GGTGACTACTCTGGAGGTGCAGG - Intergenic
900595208 1:3477301-3477323 GGTGGGTAGTGTGGGGGTGACGG - Intronic
908740153 1:67319003-67319025 GATGGCTAGGCTAGAGGTAGAGG + Intronic
911276127 1:95861599-95861621 GGTGGTTAGTGTGGAGGTGGAGG + Intergenic
913128291 1:115813657-115813679 GGAGACTATTCTAGAAGTGAAGG - Intergenic
916507972 1:165445172-165445194 GGTGGCAAGAGTAGCGGTGACGG - Exonic
917580989 1:176377576-176377598 TGAGGCTAGGCTAGGGGTGAAGG + Intergenic
919962336 1:202484660-202484682 TAAGGCTAGTCTAGTGGTGATGG + Intronic
920422135 1:205842102-205842124 GGTGGGTAGGTTTGAGGTGAGGG + Intronic
920612111 1:207451484-207451506 GGTGGAGAGGATAGAGGTGATGG + Intergenic
922095926 1:222442744-222442766 GGTGGCTGGTCTAGGGCTCATGG - Intergenic
1063816483 10:9780318-9780340 GGTGGCTTGTCAAAAGGTCAAGG - Intergenic
1064014823 10:11763590-11763612 GGTGGCTGGGCCAGAGGGGAAGG - Exonic
1065548474 10:26846185-26846207 GGTGGCTAGTCTAGAGGTGATGG - Intronic
1066201263 10:33144324-33144346 GGTGGTTAGTCTGAGGGTGAAGG - Intergenic
1066364493 10:34763667-34763689 GGTGTCTAGTTTGTAGGTGATGG - Intronic
1067767410 10:49097360-49097382 GGAGAAAAGTCTAGAGGTGATGG + Intronic
1072285348 10:93909092-93909114 GGTGGTTAGTGTAGCTGTGATGG - Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1075908613 10:126104563-126104585 GGAGGACAGTCTGGAGGTGAAGG + Intronic
1076398016 10:130155667-130155689 AGTGTATAGTCTGGAGGTGAGGG + Intronic
1076647806 10:131965384-131965406 GTTGGCCAGTCCAGAGCTGAAGG + Intergenic
1077864182 11:6209822-6209844 GGTGGCCAGTTTATAGGTCAGGG - Intronic
1082099376 11:48159403-48159425 GGTGGCTACTCTAGGGGCAAAGG + Intronic
1083222007 11:61258753-61258775 TGTGGAGAGTCTAGAGGTGGTGG + Exonic
1086594964 11:88559796-88559818 TGTGGCGAGTCTAGAGATGATGG + Intronic
1088797323 11:113274634-113274656 GGTGGCTATGCGAGAGTTGAGGG - Intronic
1089810329 11:121126164-121126186 GGTGGGTTGTCCAGAGGTGGAGG + Intronic
1092242320 12:6842972-6842994 GGTGTCTGGCCTAGAGGTGGTGG + Exonic
1093099562 12:15011262-15011284 GTGGGCTAGGCTAGTGGTGATGG - Intergenic
1097224193 12:57467519-57467541 GGTGGCTTCTCAAGAGGGGAGGG - Intronic
1099401476 12:82207441-82207463 GGTGTCTACTGTTGAGGTGAGGG - Intergenic
1102024184 12:109704089-109704111 AGTGGCTATTTGAGAGGTGATGG - Intergenic
1102835619 12:116056112-116056134 TGTGGCTAGTGTTGTGGTGAGGG - Intronic
1107177852 13:37420527-37420549 GATGGCTAATTTAGAGGTGAAGG + Intergenic
1107245922 13:38293680-38293702 GAAGGCTAGTCTAATGGTGATGG - Intergenic
1112576585 13:100641792-100641814 GGTGGATAGTTTAGAAATGAAGG - Intronic
1115563099 14:34600900-34600922 GGTGGCTACTCGGGAGGTGGAGG + Intronic
1120073181 14:80125907-80125929 AGTGGCTAGTCTAGGGTGGAAGG + Intergenic
1121600533 14:95199869-95199891 GCTGGCTTGGCTAGAGGGGAGGG + Intronic
1126446945 15:48757891-48757913 GGTGACTCGGATAGAGGTGATGG + Intronic
1133230018 16:4361978-4362000 GGTGGCTGTGCTTGAGGTGAGGG - Exonic
1142053313 16:87974819-87974841 GGTGGCTCGTCCAGTGGTTAAGG + Intronic
1143538107 17:7553697-7553719 GGTGGCTGGTGCAGGGGTGAGGG + Intronic
1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG + Exonic
1144723038 17:17485502-17485524 GGTGGCTGGTCTAGAGGAGATGG + Intronic
1149461034 17:56830587-56830609 GGTGGCTAATTGAGAGGAGATGG - Intronic
1152326621 17:79645316-79645338 GGTGGCTAGTCAGGAGGAGGAGG - Intergenic
1156889520 18:42174695-42174717 GGTGGCTTTTCAGGAGGTGAAGG - Intergenic
1165306725 19:35007208-35007230 GGTGTCCAGGCTGGAGGTGATGG + Intronic
1166134923 19:40770407-40770429 ACTTGCCAGTCTAGAGGTGAGGG + Intergenic
1166879950 19:45922631-45922653 GGTGGCTGGACTAGAGGGAAGGG + Intergenic
925382761 2:3438302-3438324 GGGGGCTAATCCAGGGGTGATGG - Intronic
929772139 2:44901211-44901233 GGTGGCCACTCTGTAGGTGAAGG + Intergenic
931010780 2:57910721-57910743 GGTGGCTATGGTAGTGGTGATGG + Intronic
932363505 2:71130233-71130255 CGTGGCTAGTCTTGACGTGGCGG - Exonic
938279004 2:130051609-130051631 GGAGGCTAGTCTAGGGATGGAGG - Intergenic
938329987 2:130442485-130442507 GGAGGCTAGTCTAGGGATGGAGG - Intergenic
938359958 2:130679018-130679040 GGAGGCTAGTCTAGGGATGGAGG + Intergenic
938436366 2:131285739-131285761 GGAGGCTAGTCTAGGGATGGAGG + Intronic
939512441 2:143123724-143123746 GGTGGCCAGTGTACAGGTCAAGG - Intronic
942186759 2:173431592-173431614 GGTGCCAAGTCTAGAGGTGGCGG - Intergenic
944850377 2:203713314-203713336 GATGGCTAGTCGAAAGGAGAGGG + Intronic
1170579902 20:17690895-17690917 GGTTGATAGTCTAGTGGTGATGG + Intergenic
1173898788 20:46571761-46571783 GGAGGCTATTCTAGATGTGGGGG + Intronic
1175153418 20:56953317-56953339 GATGGCTTGTCTAGCGATGAGGG + Intergenic
1183500424 22:38175457-38175479 CGTGGCTGGAGTAGAGGTGAGGG - Intronic
1184190990 22:42894222-42894244 AGTGGCTAGGCTGGAGCTGAAGG + Intronic
1184516403 22:44965361-44965383 GGTGGCTAGTGTAGTGGTGGCGG - Intronic
950035011 3:9878935-9878957 GGTCTCTGGACTAGAGGTGAGGG - Intronic
951971112 3:28444570-28444592 GGTGTCTACTCTAAAAGTGAAGG - Intronic
952649599 3:35709369-35709391 GCTGGCTAATGTGGAGGTGAAGG - Intronic
953913835 3:46905796-46905818 GGTGCCTAGTCTAAAGGGGGAGG - Intergenic
963007699 3:140741296-140741318 GTTGTCTAGACAAGAGGTGATGG - Intergenic
963525253 3:146408424-146408446 GGTGGCTATCCAAGAGGTGCAGG - Intronic
964044015 3:152299519-152299541 GGTGTCTGGGCTAGAGGTGGAGG - Exonic
964936134 3:162090349-162090371 GGGGGTTAGTGGAGAGGTGATGG - Intergenic
966731805 3:183157921-183157943 GGTGGGGTGGCTAGAGGTGATGG + Intronic
967875027 3:194262732-194262754 GGTTGCTGGTCCTGAGGTGAAGG + Intergenic
970399528 4:15703921-15703943 TGTGTGTATTCTAGAGGTGAGGG + Intronic
970399553 4:15704132-15704154 TGTGTGTGGTCTAGAGGTGAGGG + Intronic
970399557 4:15704158-15704180 TGTGTGTGGTCTAGAGGTGAGGG + Intronic
970399596 4:15704543-15704565 TGTGTGTGGTCTAGAGGTGAGGG + Intronic
970887148 4:20999580-20999602 GGTGGCTGGTCTAAAGGTAAAGG + Intronic
971765419 4:30824583-30824605 AGTGGCTACTCTAGGGGAGAAGG + Intronic
982099876 4:151957488-151957510 TGTGTCTAGTCTAGAGCTGCGGG + Intergenic
984232519 4:177115790-177115812 GGTGGCTGCTGTAGAGATGATGG + Intergenic
986488915 5:8269474-8269496 GGTGGCTCCTGTGGAGGTGAGGG + Intergenic
991403894 5:66282994-66283016 TGGGGCTAGGCTAGTGGTGATGG - Intergenic
995679191 5:114698008-114698030 GGTGAGTAGTCAAGTGGTGAAGG - Intergenic
996775624 5:127129345-127129367 GGTAGCCATTCTAGAGGTAAGGG + Intergenic
997431288 5:133842925-133842947 GGTGGCCAGTCTAGAGCTCTGGG - Intergenic
1000243999 5:159433857-159433879 GCTGGCAAGTCTGGGGGTGATGG + Intergenic
1002587886 5:180263574-180263596 GGTGGCGTGGCTAGAGATGAGGG - Intronic
1003337007 6:5183169-5183191 GCTGGCTAATCTAGAGCTTATGG + Intronic
1004818128 6:19334673-19334695 GGTGGGTAGTTAAGAGGTTAAGG + Intergenic
1007173670 6:39882111-39882133 GGAGTCTAGACTAGAGATGATGG + Intronic
1007224940 6:40306992-40307014 GGTGGCAAGTGGAGAGGGGATGG + Intergenic
1010671219 6:78689018-78689040 ATTGGATAGTCTAGAGGAGAAGG - Intergenic
1012877587 6:104746466-104746488 GGCAGTTAGTCTGGAGGTGAGGG + Intronic
1016741564 6:147534104-147534126 GGTACCTAGAATAGAGGTGAAGG + Intronic
1018272726 6:162097568-162097590 AATGGTTAGCCTAGAGGTGAAGG - Intronic
1027528136 7:79296719-79296741 GCTGGTTAGTATAGAGGAGAGGG + Intronic
1028898389 7:96067577-96067599 GGTGGGTAGGGTAGAGGTGGAGG - Intronic
1032470688 7:132176250-132176272 TGTGGCCAGTGTAGAGGTGCAGG - Intronic
1032560463 7:132885661-132885683 GCTGGCTAGACTGGAGGAGAGGG - Exonic
1034116625 7:148589501-148589523 GCTGGTGAGTCTAGAGGTGCTGG - Intergenic
1034225141 7:149475684-149475706 GGTGGCTTGTCCTGTGGTGAAGG - Intronic
1034351121 7:150415341-150415363 GGTGGCAAGCCTAGAGGAGCAGG - Intergenic
1034975730 7:155448464-155448486 GGTGGGAAGTGTGGAGGTGAAGG + Intergenic
1037192267 8:16140929-16140951 GATGACTTGTCCAGAGGTGAAGG + Intronic
1038080305 8:24127452-24127474 TGTGGAGAGTCCAGAGGTGAGGG - Intergenic
1041144629 8:54860901-54860923 GGTAGGTAGGCTGGAGGTGAGGG + Intergenic
1041713843 8:60915881-60915903 AGTAACTTGTCTAGAGGTGATGG - Intergenic
1046806118 8:118480779-118480801 GGAGCCAAGTCCAGAGGTGAGGG - Intronic
1047317950 8:123751906-123751928 GGTGGTTGGAATAGAGGTGAAGG + Intergenic
1052738849 9:32374181-32374203 GCTGGCTGGTCTTGTGGTGAAGG - Intergenic
1053162192 9:35820842-35820864 CGTGACTAGTCTTGAGGTGAGGG + Intronic
1056585418 9:87924621-87924643 GGAGGCTGGTCTAGAGATGGAGG - Intergenic
1056611462 9:88128319-88128341 GGAGGCTGGTCTAGAGATGGAGG + Intergenic
1057675207 9:97132157-97132179 GGAGGCTGGTCTAGAGATGAAGG - Intergenic
1058302319 9:103391309-103391331 GGTGGCTAGTTGGGAGATGAGGG - Intergenic
1059788231 9:117610420-117610442 GGTGGCTACTTGAGAGGTGCTGG + Intergenic
1062025983 9:134341038-134341060 GGTGGGCCGTCAAGAGGTGAGGG - Intronic
1062456814 9:136643927-136643949 AGTGGCCAGTCCAGAGGAGACGG - Intergenic
1190334114 X:49252225-49252247 GGTGGGGGGTCTAGGGGTGAGGG + Intronic
1192787613 X:74350433-74350455 GGTGGGTACCCTAGAGGTCAGGG + Intergenic
1202297474 Y:23375599-23375621 TAAGGCTAGTCTAGTGGTGATGG + Intergenic
1202573335 Y:26294998-26295020 TAAGGCTAGTCTAGTGGTGATGG - Intergenic