ID: 1065549191

View in Genome Browser
Species Human (GRCh38)
Location 10:26853472-26853494
Sequence GCATTTACAAAGTTTTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065549191 Original CRISPR GCATTTACAAAGTTTTGATT GGG (reversed) Intronic
900855203 1:5175982-5176004 GCATTTACATACTTGTGACTTGG - Intergenic
900901604 1:5520275-5520297 TCATTTACAAAGATATGGTTTGG - Intergenic
901661695 1:10802151-10802173 ACTTTTAAAAAGTTTTAATTAGG - Intergenic
903620722 1:24696102-24696124 GCATTTACATAGTGTGGATCTGG + Intergenic
904388431 1:30162709-30162731 GCATTTACTAACTGTTTATTTGG + Intergenic
908423809 1:63985450-63985472 GCATTTAGAATTTTTTGATTAGG - Intronic
908650305 1:66325719-66325741 TCATTGACAGAGTTTTGATTTGG - Intronic
909734376 1:78937737-78937759 CCATTTTCAAAGTTTTGGGTGGG - Intronic
909794791 1:79719689-79719711 GCATTCACAAAGATATTATTTGG - Intergenic
910090272 1:83454240-83454262 GCTTTTGGAAAGTTTTGTTTGGG - Intergenic
912028552 1:105208825-105208847 GCATTTAAAAGGTTTTGTTTTGG - Intergenic
913265713 1:117041600-117041622 TGATTTACAGAGTTTTAATTTGG + Intergenic
913710056 1:121473688-121473710 GTATTTACAAAGATATGGTTTGG - Intergenic
914835338 1:151201939-151201961 GCAATTACCATGTTTGGATTTGG - Intronic
915380701 1:155437269-155437291 GCTTTTTCAATTTTTTGATTGGG - Intronic
917229480 1:172820581-172820603 TCAATTACAAAGTATTGATGAGG - Intergenic
917905157 1:179581111-179581133 TCATTTAAAAAATTTTGATTAGG - Intergenic
918165981 1:181948292-181948314 GCATTCACAAAGGTATGGTTTGG + Intergenic
918600906 1:186359541-186359563 GCATTTACTATGTTTTCCTTAGG - Intronic
920592377 1:207232724-207232746 GCATTTCCAAAGTTCTCATGAGG - Intergenic
922216010 1:223520545-223520567 GCATTTACAATGATTATATTTGG + Intergenic
923298879 1:232622022-232622044 CCATTTAAAATGTTTTAATTTGG - Intergenic
923961725 1:239092328-239092350 GCATGTACAAAATTTAGTTTTGG + Intergenic
924132311 1:240924066-240924088 CCATATCCAAAGTTTTGTTTTGG - Intronic
924231626 1:241966707-241966729 TCATTTTAAAAGTTTTTATTTGG - Intergenic
924606108 1:245536976-245536998 GCAATTTCAGAGTTTTGCTTGGG + Intronic
1063526247 10:6789070-6789092 AGATGTACAAAGTTTTGCTTTGG - Intergenic
1063536375 10:6887889-6887911 GCATTTACTAAGAATTGAATTGG - Intergenic
1063790113 10:9435115-9435137 GCATTTAGGGAGATTTGATTAGG - Intergenic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1064894927 10:20224316-20224338 GCATTTACAACATTTTCTTTTGG + Intronic
1065356234 10:24844805-24844827 GCAGTTACAAAGATTTGCCTGGG - Intergenic
1065524192 10:26601910-26601932 GCATTTACTGGATTTTGATTTGG + Intergenic
1065549191 10:26853472-26853494 GCATTTACAAAGTTTTGATTGGG - Intronic
1065869369 10:29943240-29943262 GCATTTAAAAACTTATAATTTGG + Intergenic
1065877484 10:30010199-30010221 GCATTCAAAAAGTTTTGGATTGG + Intergenic
1069775284 10:70923620-70923642 GTATTAAAAAAGTGTTGATTGGG + Intergenic
1070937654 10:80313921-80313943 GATTTTAAATAGTTTTGATTTGG - Intergenic
1071131735 10:82401807-82401829 AGATTTATAAAGTTTTTATTTGG + Intronic
1071207998 10:83305721-83305743 GCTTTTATAAAGTTTTAATTGGG - Intergenic
1072339282 10:94431009-94431031 GTATTTATATAGTGTTGATTGGG + Intronic
1073394446 10:103206559-103206581 GCATTTATCAAGTTTGTATTGGG - Intergenic
1074417196 10:113277236-113277258 GATTTTACAAATTTGTGATTGGG - Intergenic
1075751328 10:124774064-124774086 GCATTTAAAACCTTTTGATGTGG + Intronic
1079938452 11:26647968-26647990 GCATTTATAATGTGTTTATTAGG + Intronic
1079949456 11:26783895-26783917 GCATTCACAAAGTTATGGTTTGG + Intergenic
1080380501 11:31766791-31766813 TAATTTACAAATATTTGATTGGG + Intronic
1080669446 11:34362778-34362800 GCATATACAAAGTCTTAAATGGG + Intergenic
1080951051 11:37033477-37033499 GCAGGTGCAAAGCTTTGATTGGG + Intergenic
1081025849 11:38014222-38014244 GCATATCCATATTTTTGATTAGG + Intergenic
1081236489 11:40653585-40653607 GCATTCACAAAGATATGGTTTGG + Intronic
1081349170 11:42027386-42027408 GTATTCACAAAGATATGATTTGG - Intergenic
1082673211 11:56060135-56060157 GACTTCCCAAAGTTTTGATTAGG - Intergenic
1084290883 11:68166098-68166120 GAAGTTAGAAAGTTTTGACTTGG - Intronic
1085161264 11:74348255-74348277 GGATGTACAAAGTTTTGCTGTGG - Intronic
1085978760 11:81694776-81694798 GCATTAATAAAGTTTTGTTTGGG - Intergenic
1087730103 11:101768691-101768713 GTATTCACAAAGTTATGGTTTGG - Intronic
1088022031 11:105131098-105131120 GCATTCACAAAGAGATGATTTGG - Intergenic
1088246809 11:107826542-107826564 ACTTTTAAAAAGTTTTGTTTTGG - Intronic
1090787439 11:130062274-130062296 GCGTATACTAAGTTTTGTTTTGG - Intergenic
1092268542 12:7002504-7002526 GTATTTACAGAGATTAGATTTGG - Intronic
1092442063 12:8513310-8513332 ACATTTACTAAATTTTTATTGGG + Intronic
1092698905 12:11205003-11205025 GATTTTACATAGTTTTGATTTGG + Intergenic
1093323922 12:17749281-17749303 TCATTTAGAAAGTTTAGTTTTGG + Intergenic
1093397414 12:18700357-18700379 CCATTTCCCAAGTTTTGTTTTGG + Intronic
1093759756 12:22895467-22895489 CCATTTAGAAAATCTTGATTTGG + Intergenic
1093868774 12:24261413-24261435 GCATTTACACAGTTTCTGTTGGG + Intergenic
1094231663 12:28111793-28111815 GCATTTTCTAAGTTTGGGTTTGG - Intergenic
1095112434 12:38312770-38312792 ACATTTAGGAAGTTTTGCTTTGG + Intergenic
1095412840 12:41943278-41943300 GCATTTACAAAGTGTCCGTTGGG - Intergenic
1096667033 12:53172766-53172788 TCATTTTCAGAGTTTTGCTTTGG - Intronic
1097364183 12:58692900-58692922 GCATTTACACAGTTATTATATGG + Intronic
1098870359 12:75810706-75810728 GCATTTTCAAACTTCTGTTTGGG - Intergenic
1098944474 12:76574273-76574295 GCATTCACAAAGATATGGTTTGG - Intergenic
1099778701 12:87166464-87166486 GCATTCACAAAGATATGGTTTGG - Intergenic
1101480456 12:105091604-105091626 GCATTTACAAATGCTTGGTTTGG + Intergenic
1101622978 12:106408234-106408256 GCATTTGGAAAGTATTGTTTAGG + Intronic
1102657073 12:114491039-114491061 GCATCTACATAGTATTGAGTAGG - Intergenic
1102762662 12:115402145-115402167 GCATTTATACAGTTTTACTTAGG + Intergenic
1104295697 12:127510650-127510672 GCATTAAGAAAATTTTGCTTGGG - Intergenic
1104657363 12:130583337-130583359 GCACCTACAAAGTGTTTATTAGG - Intronic
1106496802 13:30286038-30286060 GCATTCACAAAGATATGGTTTGG + Intronic
1106746334 13:32712076-32712098 GCATTGACAAAGTTCAAATTTGG + Intronic
1109458094 13:62619654-62619676 TCAGTTTCAAAATTTTGATTAGG - Intergenic
1109825012 13:67707444-67707466 TCTTTTACTAAGTTTTGGTTGGG + Intergenic
1110334017 13:74305277-74305299 GCATTTAAAAATTTTGGATTAGG - Intergenic
1110376316 13:74798073-74798095 ACATTTACAAAATTGAGATTAGG - Intergenic
1110620566 13:77590185-77590207 TCAGTTACAAAGTTTTGACTGGG + Intronic
1110732283 13:78892938-78892960 GCATATAAAAACTTTTGATAAGG - Intergenic
1110970840 13:81758922-81758944 GTATTTACAAAGATATGATTTGG - Intergenic
1111162132 13:84408435-84408457 GCAATTACAAATTTGTGATGAGG - Intergenic
1111737929 13:92165294-92165316 TCATTTACAAAGATATGATTTGG - Intronic
1112031420 13:95459894-95459916 GCATTCACAAAGAGATGATTTGG - Intronic
1114357365 14:21926065-21926087 GCATCTACATAGCCTTGATTTGG + Intergenic
1114419477 14:22569132-22569154 GCAGTTAAAAAGTGTTTATTTGG + Intronic
1114992802 14:28309392-28309414 CCATTTGTAAAGTGTTGATTTGG + Intergenic
1115172316 14:30523492-30523514 GCATTCATAAAATTTAGATTTGG + Intergenic
1116008178 14:39320063-39320085 GTAGTAACAAAGTTTGGATTGGG + Intronic
1117632667 14:57709838-57709860 GCATTCACAAAGATATGGTTTGG + Intronic
1117672318 14:58121198-58121220 GCATTTAACAAGTATTTATTTGG - Intronic
1117742976 14:58836858-58836880 TCATTTACAAAATTTTTATTGGG + Intergenic
1118121567 14:62850434-62850456 GCATTGCCAAAGTTTTATTTTGG - Intronic
1122119675 14:99545459-99545481 GCAATTACACAGTTTTCATTTGG - Intronic
1124365352 15:29067298-29067320 ACATCTAAATAGTTTTGATTTGG - Intronic
1125475043 15:40041535-40041557 GGAAGTAAAAAGTTTTGATTTGG - Intergenic
1125801816 15:42455459-42455481 GCATTTTCAGACTTTGGATTAGG + Intronic
1126604822 15:50465516-50465538 GGATTTGCCAACTTTTGATTTGG + Intronic
1126857190 15:52850042-52850064 GCATTTATATAGTTTTGAGCAGG + Intergenic
1130439096 15:83933449-83933471 GCATTCACAAAGAGATGATTTGG + Intronic
1131725981 15:95225281-95225303 GAATTTAAAAAATTTTGTTTAGG - Intergenic
1141286432 16:82676838-82676860 GTATTTACACAGTTTTGTTTTGG + Intronic
1144102511 17:11954354-11954376 GTATTTACAATGTTTTCATTAGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1154099980 18:11463962-11463984 GCAGTTACAAAATTTCCATTTGG + Intergenic
1156000232 18:32377158-32377180 GTATTTACAGAGTATTGAGTTGG + Intronic
1157840393 18:50952583-50952605 CCAATTGCAAAGTTTTTATTTGG - Exonic
1159286610 18:66362154-66362176 GCATCAACAAAGGTTTAATTGGG + Intergenic
1159394002 18:67832186-67832208 ACATTTACAAAGTTTGGCTTTGG - Intergenic
1160206192 18:76835104-76835126 GCATCCACAAAATTTTGATGTGG + Intronic
1163356784 19:16817903-16817925 GCATTTCCAATGTTTAAATTAGG - Exonic
1166252808 19:41583032-41583054 GTATTTACAAAGGTATGGTTTGG - Intronic
1167129557 19:47575034-47575056 TCATTTAGCAAGTTTTTATTGGG + Intergenic
925950302 2:8903130-8903152 GCATTTACAAACCTTTAACTAGG + Intronic
925950708 2:8907668-8907690 GCATTTAAATTGTTTTGTTTTGG + Intronic
926207156 2:10841914-10841936 GCATTTAAAAAATTGTGATAGGG + Intergenic
926463400 2:13161784-13161806 GTATTTATAAAGTTTTGGTAAGG + Intergenic
926762118 2:16287375-16287397 GCATTTACAAATTTTGGAGGTGG + Intergenic
928158613 2:28900131-28900153 CCATTTAGATAGTTTTTATTTGG + Intronic
929676555 2:43938109-43938131 GCATTGACTAAATTTTTATTAGG - Intronic
929977170 2:46646150-46646172 GCAATTTCAAAGTTATGATGAGG - Intergenic
930041158 2:47125592-47125614 CCATTTACACATTTTTGCTTTGG + Intronic
931162290 2:59705029-59705051 GCATTCACAAAGAGATGATTTGG - Intergenic
931688017 2:64811266-64811288 GCATTTATAGAGTGTTGCTTTGG + Intergenic
931804473 2:65790595-65790617 GCATTTACCTTGTTTTGGTTTGG + Intergenic
933856895 2:86423155-86423177 GCATTCACGAAATCTTGATTTGG + Intergenic
934791350 2:97064657-97064679 GCACTTACAAAGTTATGGTTTGG - Intergenic
934815083 2:97317886-97317908 GCACTTACAAAGTTATGGTTTGG + Intergenic
934822612 2:97390597-97390619 GCACTTACAAAGTTATGGTTTGG - Intergenic
936506802 2:113114586-113114608 CCACTTACAAAGTTATGATCAGG + Intronic
937640301 2:124204063-124204085 TCATTTCCAAAGATATGATTTGG - Intronic
937760998 2:125603659-125603681 GCATTCACAAAGATATGGTTTGG + Intergenic
940621667 2:156121249-156121271 GTATTCACAAAGTTATGGTTTGG + Intergenic
941567089 2:167122872-167122894 GCATTTACAGTTTTTTTATTTGG + Intronic
941828264 2:169924186-169924208 GCATTTAAAAAGTTTTGAAGTGG + Intronic
942510149 2:176689660-176689682 TCATTTACAAGGTTTTCCTTAGG + Intergenic
944869929 2:203899704-203899726 TCATTGCCAATGTTTTGATTTGG - Intergenic
946634775 2:221712579-221712601 GCCATTAGAAAGTTTTGAGTTGG - Intergenic
947198662 2:227595539-227595561 CCACTTACAAGGTTTTGATGTGG + Intergenic
948837634 2:240633630-240633652 GCATTCACAAAGAGATGATTTGG + Intergenic
1169409443 20:5355111-5355133 GCACTTACAAACTTTTGTTTGGG + Intergenic
1169850308 20:10041906-10041928 ACATGAACAAAGTCTTGATTGGG + Intronic
1170269556 20:14509266-14509288 ACATTTACAATTTTTTAATTGGG + Intronic
1170337154 20:15282407-15282429 GCATTCACAAAGATGTGGTTTGG - Intronic
1170432674 20:16290842-16290864 GCATTTGAGAAGTTTTGATCTGG - Intronic
1171147377 20:22797070-22797092 GCATTTAAAAAATATTAATTTGG - Intergenic
1172230934 20:33335365-33335387 GCCTGTACAAATTTTTTATTAGG - Intergenic
1172324306 20:34022565-34022587 GCACTTACAAAGTTTCTGTTTGG - Intronic
1172854254 20:37989292-37989314 GCATTTAAATATTTTTGATATGG - Intronic
1175409783 20:58759576-58759598 GCATTTAAAGAGCTTAGATTTGG - Intergenic
1175639951 20:60620675-60620697 GCATCCACAGAGTTTGGATTTGG + Intergenic
1176054413 20:63136171-63136193 GTTTTTAAAAAGTCTTGATTAGG - Intergenic
1176883700 21:14229346-14229368 GCATTCACAAAGATATGGTTTGG + Intergenic
1177499918 21:21940501-21940523 GCATTTACAAACTTTTGAACCGG + Intergenic
1181816813 22:25444578-25444600 GCATTTTTAAAGTTTTGTCTAGG + Intergenic
1182635147 22:31720426-31720448 GTATTTACAAATTCTTGAATAGG - Intronic
1182726476 22:32450714-32450736 GCACTTAAAAATTTTGGATTTGG - Intronic
1184448209 22:44566306-44566328 GCATTTTCAAATTTTAGAATCGG - Intergenic
1185162144 22:49236548-49236570 GCATTCACAGAGTCCTGATTGGG + Intergenic
949740922 3:7233064-7233086 GCTATTACCAAGTTTTGATTTGG + Intronic
951366435 3:21788658-21788680 GCTTTTTTAAATTTTTGATTCGG + Intronic
952216328 3:31281433-31281455 CCATTTACAAAATGTTGGTTTGG - Intergenic
952557813 3:34553273-34553295 GAATTCATAAATTTTTGATTTGG + Intergenic
954445473 3:50544053-50544075 GCAAAAACAAAGGTTTGATTTGG + Intergenic
954721378 3:52566681-52566703 ACAGGTACAAAGTTTTTATTTGG + Intronic
955159739 3:56453040-56453062 GCATGTGCAAAGTTTTTTTTTGG - Intronic
957382978 3:79457958-79457980 GTAATTACAAAATTTTAATTAGG + Intronic
957457582 3:80472400-80472422 GTATTGACAAAGATATGATTTGG + Intergenic
957751946 3:84431608-84431630 GAATTTACAAAATTTAAATTGGG - Intergenic
958454529 3:94313162-94313184 GCATTTTCAAATTTTTAATTAGG + Intergenic
959368344 3:105491520-105491542 GTATTCACAAAGATATGATTTGG - Intronic
959873332 3:111353105-111353127 GCAGATACAAATTTTTTATTAGG + Intronic
959955212 3:112229884-112229906 TCATTGAAAAATTTTTGATTTGG + Intronic
960434532 3:117609521-117609543 GTTTTTACAAAGTGCTGATTCGG + Intergenic
961792872 3:129389178-129389200 GCCTTTACAAAGGTTAGATGTGG - Intergenic
961806791 3:129495370-129495392 GCCTTTACAAAGGTTAGATGTGG - Intronic
963593485 3:147294561-147294583 GCATTTAGAAGGATTTGCTTTGG + Intergenic
963967632 3:151390627-151390649 TCATTTAGAAAATTTTCATTTGG - Intronic
965656480 3:170990219-170990241 GTCTTTTCAAAGTTTTCATTTGG - Intergenic
967924513 3:194635551-194635573 GTGTTTTCAAAGTTATGATTTGG + Intergenic
968845689 4:3040479-3040501 CCATTTACAAACTTTTGGGTGGG - Intronic
969987466 4:11226506-11226528 ATATGTACAAAGTTTTGAATTGG - Intergenic
970721908 4:18997796-18997818 GTATTCACAAAGATATGATTTGG - Intergenic
971664528 4:29465013-29465035 CCATTTACAAAAGTTTGAGTTGG + Intergenic
971717022 4:30191098-30191120 ACATTTAAAAAGATTTTATTGGG - Intergenic
971747892 4:30608352-30608374 GTAATTACAAAGTTGTGACTTGG + Intergenic
973133745 4:46679884-46679906 GTATTAACAAAGTTTTGGATAGG - Intergenic
974296376 4:60004293-60004315 CCATTTTCAATGTTTTGTTTTGG - Intergenic
974557122 4:63465289-63465311 GCATTCACAAAGATATGGTTTGG - Intergenic
974832820 4:67210646-67210668 GTATTCACAAAGATATGATTTGG + Intergenic
974969536 4:68807163-68807185 GTATTTACAAAGATGTGGTTTGG + Intergenic
975005108 4:69274148-69274170 GTATTTACAAAGATATGGTTTGG + Intergenic
975013531 4:69383129-69383151 GTATTTACAAAGATATGGTTTGG + Intronic
975447914 4:74488651-74488673 GTATTTTAAAAGTCTTGATTTGG + Intergenic
976032630 4:80775430-80775452 GCATTTACTAATTTATGACTAGG + Intronic
976283938 4:83352808-83352830 GCATGAGCAAAGTTTTTATTAGG - Intergenic
977458252 4:97291214-97291236 TCATATACAAACTTTTGTTTGGG + Intronic
978769826 4:112443348-112443370 GCCTTAAGAAAGTTTTGGTTAGG - Intergenic
979308915 4:119179087-119179109 ACAGTTACAAAGTTTTTAGTTGG - Intronic
980690262 4:136287448-136287470 GCATATGCAAAGATTTTATTGGG - Intergenic
981147449 4:141341710-141341732 ACATTTACAAAGTTGTGCTGGGG + Intergenic
981205019 4:142030615-142030637 GTATTCATAAAGTCTTGATTTGG - Intronic
981703792 4:147637861-147637883 TATTTTTCAAAGTTTTGATTTGG - Exonic
982364736 4:154564788-154564810 GCAATAGGAAAGTTTTGATTTGG - Intronic
982958184 4:161798595-161798617 TGATTGATAAAGTTTTGATTGGG - Intronic
983542411 4:168926606-168926628 GCAATTCCAAAGTTTTAAATTGG - Intronic
986554232 5:8995036-8995058 TCATTTACAAAGATATGGTTTGG + Intergenic
986976596 5:13401651-13401673 GCATTTATAAACTTTTAACTAGG - Intergenic
988359912 5:30222746-30222768 GCATTTTTAAAGTTTTTTTTTGG - Intergenic
989073276 5:37534263-37534285 CCATTTAAAAGGTTTTGAATGGG + Intronic
989280496 5:39636878-39636900 AAATATTCAAAGTTTTGATTAGG - Intergenic
990088418 5:52008346-52008368 GCAATTCCAAAGTTTTGATTTGG - Intronic
990852505 5:60223022-60223044 GCATTTACATATTTTTGCTTAGG - Intronic
991618555 5:68521123-68521145 ATAGTTACAAAGTTTTGCTTAGG + Intergenic
993431176 5:87833431-87833453 TCATTTGCAAAGTTGAGATTTGG - Intergenic
994004874 5:94826244-94826266 TCATTTACTAACTTTAGATTTGG + Intronic
994370203 5:98959016-98959038 ACATTTACAATGTTTGGAATCGG + Intergenic
995655279 5:114419441-114419463 GCATTTAAAAATTTTTACTTTGG + Intronic
995926881 5:117385703-117385725 GCATTTCCTATGTTGTGATTTGG + Intergenic
996283104 5:121756080-121756102 GAAATTTCAAAGTTTAGATTTGG - Intergenic
996415833 5:123209176-123209198 GCTTTTAAAAAGTTTTCCTTTGG + Intergenic
998114221 5:139524150-139524172 GCATTTACTGAGTGTTTATTAGG - Intergenic
999070079 5:148735451-148735473 GCATTTCCACAGTTCTGATGAGG - Intergenic
1000516052 5:162237269-162237291 GCATTTACAAAGAGATGTTTTGG - Intergenic
1002571543 5:180142447-180142469 ACATTTCCAAGGCTTTGATTAGG - Intronic
1004650377 6:17601570-17601592 GGAGTTAGGAAGTTTTGATTGGG + Intronic
1004814748 6:19300806-19300828 CCATTTTCAATGTTTTGACTAGG + Intergenic
1004836697 6:19539105-19539127 ACATTTACAAAATATTTATTGGG - Intergenic
1005089009 6:22036699-22036721 CCATTTACAAGGTTTTTTTTTGG - Intergenic
1005911892 6:30317805-30317827 GAATTTAGAATGTTTTGCTTAGG - Intergenic
1006544776 6:34770809-34770831 ACATTTTCTCAGTTTTGATTTGG + Intronic
1007851731 6:44809639-44809661 ATTTTTAAAAAGTTTTGATTAGG + Intronic
1008226569 6:48925782-48925804 ACAATTACAAATTTTTAATTTGG + Intergenic
1008559263 6:52707385-52707407 GCTTTTACAAATTTTTGTTAAGG - Intergenic
1008888795 6:56461341-56461363 ACATTTTCAAGGTTATGATTAGG - Intronic
1010157019 6:72806707-72806729 GCATTTCCCATATTTTGATTTGG + Intronic
1010796942 6:80127731-80127753 ACATTTTCAAAGGTATGATTGGG + Intronic
1011337468 6:86276755-86276777 GCATTTACAACGTATTGAGTTGG - Intergenic
1011390414 6:86846502-86846524 GTTTTAACAAAGTTTTGCTTTGG - Intergenic
1013338605 6:109191291-109191313 GGATTTGCAAAGTTATGGTTTGG + Intergenic
1013370542 6:109467129-109467151 TCATTTATTAAATTTTGATTGGG - Intronic
1013981317 6:116133056-116133078 TCATTTACAAAGTTTTAACAAGG + Intronic
1014047465 6:116907982-116908004 ACATTAACAAAATTTTGATTAGG - Intronic
1014231732 6:118911002-118911024 GTATTTTTACAGTTTTGATTGGG - Intronic
1014349980 6:120328931-120328953 GTATTTATGAAGTTTTGATCTGG + Intergenic
1014356384 6:120416192-120416214 ACAATTACAAAGCTCTGATTGGG + Intergenic
1015748213 6:136533586-136533608 TAATTTACAAAGTTTTGTTTTGG + Intronic
1015772953 6:136787564-136787586 GCATTTTCAAGGTTTGGCTTTGG - Intronic
1015853059 6:137594089-137594111 GTATTTACAAAGATATGGTTTGG - Intergenic
1016359615 6:143253225-143253247 GCATTTCCTAAGTATTGAATGGG + Intronic
1017341861 6:153333376-153333398 GCATATATAAAATTTTGGTTTGG - Intergenic
1017773542 6:157662025-157662047 CCATGCACAAAGTTCTGATTTGG - Intronic
1017930136 6:158945256-158945278 ACAATTACAGAGTTTTCATTTGG - Intergenic
1018415449 6:163598418-163598440 GCATTTTCATACTTTTGACTTGG - Intergenic
1019039297 6:169090431-169090453 GCATTCACAAAGATATGGTTTGG + Intergenic
1019960889 7:4458475-4458497 GCTTTCACATAGATTTGATTTGG - Intergenic
1020517865 7:9147145-9147167 AAATTTATAAATTTTTGATTAGG + Intergenic
1021250234 7:18316396-18316418 GCATTTAGAATCTTTTCATTGGG + Intronic
1021341341 7:19466246-19466268 TCATTTTCAAGGTTTTGATCAGG + Intergenic
1021972290 7:25977463-25977485 AAATTTACAAAGATTTGATTTGG + Intergenic
1022074597 7:26954838-26954860 GCATTTACCAAGTGTTAATTAGG - Intronic
1022171176 7:27833405-27833427 ACATATAGAAATTTTTGATTTGG + Intronic
1022183917 7:27948503-27948525 ACTCTTACAAGGTTTTGATTTGG - Intronic
1022338631 7:29447273-29447295 TCATTTCTAAAGGTTTGATTTGG - Intronic
1023644639 7:42297269-42297291 GCATTTTCAATTTTTGGATTAGG + Intergenic
1024573528 7:50745805-50745827 GCCTTTAAAAAGTTTTCTTTAGG - Intronic
1027307125 7:76910686-76910708 GCTTTTGGAAAGTTTTGTTTGGG - Intergenic
1029357729 7:100065122-100065144 GCTTTTAGAAAATTTGGATTTGG + Intronic
1030768363 7:113441026-113441048 GCATTTCAAAAATTTTGTTTCGG + Intergenic
1031167260 7:118244191-118244213 TGGTTTACTAAGTTTTGATTGGG - Intergenic
1032618717 7:133503907-133503929 GAAGTTACCAAGTTTTCATTAGG + Intronic
1033031326 7:137830135-137830157 ATATTTCCAAAGTTTTGCTTAGG - Intronic
1033713884 7:143979634-143979656 ATATTTAAAAAGTTTTGATTTGG + Intergenic
1037555714 8:20020274-20020296 GCTTTTGAAGAGTTTTGATTGGG - Intergenic
1041584218 8:59496827-59496849 GAAATTACAAAGTATTAATTTGG + Intergenic
1042568385 8:70135611-70135633 CCATTTATAAAGTTCAGATTGGG - Intronic
1042743776 8:72081193-72081215 GCATTTCATAAATTTTGATTTGG + Intronic
1043182209 8:77099342-77099364 GCAATTAAAAAGTTTTCATGTGG + Intergenic
1043186374 8:77156055-77156077 GAATTTACAAATGTTTGTTTTGG + Intergenic
1045997288 8:108378017-108378039 GCATTTGTAAAGTTATGAGTGGG + Intronic
1047359849 8:124159345-124159367 GCATTTACATAGTATTGACCAGG + Intergenic
1047897128 8:129378759-129378781 GCATTTAATTAGTGTTGATTTGG - Intergenic
1048006503 8:130423824-130423846 GCATTTACTATGTTTACATTTGG + Intronic
1049950295 9:636981-637003 GTATAAACAAAGTTTTGAATAGG - Intronic
1050746924 9:8886921-8886943 TCATTTACAAAATATTTATTCGG - Intronic
1050987586 9:12102578-12102600 GCATTTAGAAAGTGTTGGTTTGG - Intergenic
1052120719 9:24713322-24713344 GCATTTAAAAAGTATTGTGTTGG + Intergenic
1052178921 9:25501484-25501506 GCATTCACAAAGAGATGATTTGG + Intergenic
1054737338 9:68768581-68768603 GCCTTTAGAACCTTTTGATTAGG + Intronic
1055026015 9:71722363-71722385 CCAGTTAGAAAGTTTTGCTTTGG + Intronic
1055514992 9:77024540-77024562 CCATTGACAAAGTATTGGTTTGG + Intergenic
1055891273 9:81126682-81126704 ACAATTAGAAAGTTTTAATTTGG - Intergenic
1056357226 9:85813356-85813378 GCATTAACTATGTTTTGTTTTGG + Intergenic
1057485619 9:95480961-95480983 ACATTTACAAAGTATTTATTTGG - Intronic
1059229231 9:112702857-112702879 GCATTTATAAATTTTTCATCCGG - Intronic
1059600694 9:115774760-115774782 GTGTTTACAAAATTTTGCTTTGG + Intergenic
1185628546 X:1499719-1499741 TCATTTAGAAAGTTTTGGTCAGG - Intronic
1186355572 X:8785916-8785938 GTACTTAAAATGTTTTGATTTGG + Intergenic
1188621336 X:32228433-32228455 GCAATTTCAATGTCTTGATTTGG + Intronic
1188742145 X:33798210-33798232 TAATTTAGAAAGTTTTGAATTGG + Intergenic
1188766281 X:34095912-34095934 GCATTTACAAACTTTTAGCTAGG + Intergenic
1189313614 X:40037752-40037774 TCATTTACCAAGTTTTTAATTGG + Intergenic
1192052388 X:67736602-67736624 GCATTTTAATAGTTTTTATTGGG - Intergenic
1194508155 X:94759182-94759204 GCATTTTCACTGTTGTGATTTGG - Intergenic
1195043651 X:101036716-101036738 GCATTTACTAAGTGTTTACTAGG + Intronic
1196996223 X:121387336-121387358 GCATTTACAAAGAGATGGTTTGG + Intergenic
1197036144 X:121876540-121876562 CCAGTTACAATGATTTGATTGGG - Intergenic
1197812946 X:130464386-130464408 GCATTTACATAATTTTTATTTGG - Intergenic
1198035024 X:132793359-132793381 GCATGTAAAAAGAGTTGATTTGG - Intronic
1198836143 X:140806572-140806594 GTATTCACAAAGATATGATTTGG - Intergenic
1200871131 Y:8099923-8099945 GAATGTACATTGTTTTGATTTGG + Intergenic
1201566609 Y:15371362-15371384 GAATGTACATTGTTTTGATTTGG - Intergenic