ID: 1065553242

View in Genome Browser
Species Human (GRCh38)
Location 10:26889469-26889491
Sequence CATTTATACTAGGGGGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065553242_1065553247 18 Left 1065553242 10:26889469-26889491 CCTAGTGCCCCCTAGTATAAATG No data
Right 1065553247 10:26889510-26889532 GTTTGTGTGTGTTTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065553242 Original CRISPR CATTTATACTAGGGGGCACT AGG (reversed) Intergenic
No off target data available for this crispr