ID: 1065554945

View in Genome Browser
Species Human (GRCh38)
Location 10:26905825-26905847
Sequence CCCCGAGCTGTGGGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065554934_1065554945 23 Left 1065554934 10:26905779-26905801 CCGGGGGCAGGGCTTGGGACCTG No data
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data
1065554933_1065554945 24 Left 1065554933 10:26905778-26905800 CCCGGGGGCAGGGCTTGGGACCT No data
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data
1065554937_1065554945 -7 Left 1065554937 10:26905809-26905831 CCATGCCTAAGCCTCCCCCCGAG No data
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data
1065554932_1065554945 25 Left 1065554932 10:26905777-26905799 CCCCGGGGGCAGGGCTTGGGACC No data
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data
1065554935_1065554945 4 Left 1065554935 10:26905798-26905820 CCTGCAGCCTGCCATGCCTAAGC No data
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data
1065554930_1065554945 28 Left 1065554930 10:26905774-26905796 CCTCCCCGGGGGCAGGGCTTGGG No data
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data
1065554936_1065554945 -3 Left 1065554936 10:26905805-26905827 CCTGCCATGCCTAAGCCTCCCCC 0: 3
1: 218
2: 903
3: 578
4: 652
Right 1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065554945 Original CRISPR CCCCGAGCTGTGGGCTCCTG TGG Intergenic
No off target data available for this crispr