ID: 1065563071

View in Genome Browser
Species Human (GRCh38)
Location 10:26982891-26982913
Sequence GAGTGGTTTGTTTGGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065563071_1065563079 17 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563079 10:26982931-26982953 GGGCTTTGGATCTGACAGGTTGG No data
1065563071_1065563075 -4 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563075 10:26982910-26982932 ACTCAACTAGTCGATTCGTAAGG No data
1065563071_1065563078 13 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563078 10:26982927-26982949 GTAAGGGCTTTGGATCTGACAGG No data
1065563071_1065563077 3 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563077 10:26982917-26982939 TAGTCGATTCGTAAGGGCTTTGG No data
1065563071_1065563080 25 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563080 10:26982939-26982961 GATCTGACAGGTTGGTTATCTGG 0: 6
1: 2
2: 3
3: 9
4: 102
1065563071_1065563081 26 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563081 10:26982940-26982962 ATCTGACAGGTTGGTTATCTGGG 0: 5
1: 2
2: 3
3: 10
4: 106
1065563071_1065563076 -3 Left 1065563071 10:26982891-26982913 CCCAGGATCCAAACAAACCACTC No data
Right 1065563076 10:26982911-26982933 CTCAACTAGTCGATTCGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065563071 Original CRISPR GAGTGGTTTGTTTGGATCCT GGG (reversed) Intergenic
No off target data available for this crispr