ID: 1065563650

View in Genome Browser
Species Human (GRCh38)
Location 10:26987992-26988014
Sequence TTGTGTATGAATAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065563644_1065563650 -1 Left 1065563644 10:26987970-26987992 CCCAGGTGCCGTTTCTCCACTTT No data
Right 1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG No data
1065563646_1065563650 -9 Left 1065563646 10:26987978-26988000 CCGTTTCTCCACTTTTGTGTATG No data
Right 1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG No data
1065563645_1065563650 -2 Left 1065563645 10:26987971-26987993 CCAGGTGCCGTTTCTCCACTTTT No data
Right 1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065563650 Original CRISPR TTGTGTATGAATAGGGAGAA AGG Intergenic
No off target data available for this crispr