ID: 1065564199

View in Genome Browser
Species Human (GRCh38)
Location 10:26992756-26992778
Sequence GAGTGGTTGGTTTGGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 6, 2: 2, 3: 10, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065564199_1065564208 13 Left 1065564199 10:26992756-26992778 CCCAGGATCCAAACCAACCACTC 0: 2
1: 6
2: 2
3: 10
4: 138
Right 1065564208 10:26992792-26992814 CCAAGGGTTTTAGATCTGACAGG No data
1065564199_1065564211 26 Left 1065564199 10:26992756-26992778 CCCAGGATCCAAACCAACCACTC 0: 2
1: 6
2: 2
3: 10
4: 138
Right 1065564211 10:26992805-26992827 ATCTGACAGGTTGGTTATCTGGG 0: 5
1: 2
2: 3
3: 10
4: 106
1065564199_1065564210 25 Left 1065564199 10:26992756-26992778 CCCAGGATCCAAACCAACCACTC 0: 2
1: 6
2: 2
3: 10
4: 138
Right 1065564210 10:26992804-26992826 GATCTGACAGGTTGGTTATCTGG 0: 6
1: 2
2: 3
3: 9
4: 102
1065564199_1065564205 -3 Left 1065564199 10:26992756-26992778 CCCAGGATCCAAACCAACCACTC 0: 2
1: 6
2: 2
3: 10
4: 138
Right 1065564205 10:26992776-26992798 CTCAACCAGTCAATTACCAAGGG No data
1065564199_1065564209 17 Left 1065564199 10:26992756-26992778 CCCAGGATCCAAACCAACCACTC 0: 2
1: 6
2: 2
3: 10
4: 138
Right 1065564209 10:26992796-26992818 GGGTTTTAGATCTGACAGGTTGG No data
1065564199_1065564204 -4 Left 1065564199 10:26992756-26992778 CCCAGGATCCAAACCAACCACTC 0: 2
1: 6
2: 2
3: 10
4: 138
Right 1065564204 10:26992775-26992797 ACTCAACCAGTCAATTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065564199 Original CRISPR GAGTGGTTGGTTTGGATCCT GGG (reversed) Intronic
901666089 1:10827131-10827153 GAGATGTGGGTTTGGATCCTGGG - Intergenic
901740989 1:11341786-11341808 GTGTGGTTGGATTGGAGCCCAGG + Intergenic
901773504 1:11543308-11543330 GAGTGGTGGGATTGGAACCCAGG + Intergenic
903044417 1:20554301-20554323 GAGGGGTGGGTTTGGACCCTGGG + Exonic
904459109 1:30664907-30664929 GAGAGGTAGGTCTGGAGCCTCGG + Intergenic
911485504 1:98500268-98500290 CAGTGGCTGGTCTGGAACCTGGG + Intergenic
912823791 1:112887559-112887581 GATTGGTGGGAATGGATCCTGGG - Intergenic
913016050 1:114736294-114736316 GTGTGATTGGTTTAGATCTTTGG - Intronic
913495474 1:119424380-119424402 GAGTGGTTGGCTTGGATCCTGGG - Intergenic
915364382 1:155306217-155306239 GAGTGTTGTGTTTGGATGCTGGG - Intergenic
915567104 1:156721263-156721285 GAGTGGCTGGTCTGGTTCCAGGG - Intergenic
919563551 1:199155459-199155481 GAGTGATTGGTTTGGATTATGGG - Intergenic
921195366 1:212751417-212751439 GAGTGTGTGCTTTGGATTCTAGG - Intronic
922335028 1:224612285-224612307 GAGGGGTTGGTTTAGCTCTTGGG + Intronic
1063959994 10:11299220-11299242 GAGTTGTTGGTTTGTATCTCGGG + Intronic
1064280980 10:13951256-13951278 GAGTGGTTGGTGAGGATGCGGGG + Intronic
1065563071 10:26982891-26982913 GAGTGGTTTGTTTGGATCCTGGG - Intergenic
1065564199 10:26992756-26992778 GAGTGGTTGGTTTGGATCCTGGG - Intronic
1073652480 10:105376385-105376407 GAGTGATTGGTTGGAAACCTGGG + Intergenic
1077352261 11:2098484-2098506 AGGTGATTGGTTTGCATCCTTGG - Intergenic
1084443438 11:69189526-69189548 GAGGGTTTGGATGGGATCCTAGG - Intergenic
1085245335 11:75096686-75096708 GCGTGGTTGACTTGGATCCTGGG + Intergenic
1086325224 11:85691995-85692017 AAGTGGGTGGTGAGGATCCTGGG - Intergenic
1087768692 11:102183628-102183650 GGAAGGTTGGTTTGTATCCTAGG + Intronic
1088028627 11:105218601-105218623 AAGTGTTTGATATGGATCCTTGG - Intergenic
1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG + Intergenic
1089050482 11:115540810-115540832 GAATGGAGGGTTTGGAACCTTGG - Intergenic
1089835903 11:121370425-121370447 GGTTGGCTGGTTTGGGTCCTGGG - Intergenic
1090840163 11:130480497-130480519 GAGTGGTGGGCTTGAAGCCTAGG + Intergenic
1091720934 12:2813015-2813037 TCGTGGTTGGTTTTGTTCCTTGG + Intronic
1092478474 12:8838974-8838996 GTGAGGTTGGTTTGGATCTTTGG + Intronic
1102015881 12:109647705-109647727 AAGTGCTTAGTGTGGATCCTGGG - Intergenic
1103852596 12:123943028-123943050 GATTGTTTGGTTTGGATGGTTGG - Intronic
1106551383 13:30774172-30774194 GAATGCTTGGTTTTGAGCCTGGG + Intergenic
1108832871 13:54500503-54500525 CAGGGGTTGGTGTGGAGCCTGGG - Intergenic
1110206579 13:72921449-72921471 GAGTGGTTATTTTGGATGGTAGG - Intronic
1116885724 14:50219138-50219160 GAGTGGTTGGATCGGATAGTAGG - Intronic
1117833832 14:59781158-59781180 GAGACTTGGGTTTGGATCCTAGG - Intronic
1117861421 14:60096087-60096109 GAGTGGTGGGTTTGGATCCTGGG - Intronic
1118991675 14:70802354-70802376 GAATGATTGGTTGGGATACTGGG - Intronic
1120413283 14:84185510-84185532 CAGTGGTTGCTAGGGATCCTAGG - Intergenic
1121742417 14:96263603-96263625 GACAGGTTGGTTTGGCTCATAGG + Intronic
1123491882 15:20787622-20787644 GAATGAATGGTTTAGATCCTGGG - Intergenic
1123548388 15:21356717-21356739 GAATGAATGGTTTAGATCCTGGG - Intergenic
1126617481 15:50599809-50599831 GATTGTTTTGTTTGGCTCCTAGG - Intronic
1126645581 15:50871887-50871909 GAATGATTGGTTTGATTCCTAGG + Intergenic
1127226036 15:56930264-56930286 AAGTGGTTGGTTTGTACCTTTGG + Intronic
1128005413 15:64235120-64235142 GAGTAGTTGTCTTGGTTCCTAGG + Intronic
1129002778 15:72347883-72347905 GAGTGGTTGGTTTTCAGCCCAGG - Intronic
1202956719 15_KI270727v1_random:83947-83969 GAATGAATGGTTTAGATCCTGGG - Intergenic
1133501532 16:6372052-6372074 GGATGGTTGGTTAGGATCATTGG + Intronic
1133501568 16:6372207-6372229 GGGTGGTTGGTAAGGATCTTTGG + Intronic
1133501599 16:6372361-6372383 GGATGGTTGGTTAGGATCTTTGG + Intronic
1133501693 16:6372827-6372849 GGATGGTTGGTTAGGATCTTTGG + Intronic
1133501722 16:6372983-6373005 GGGTGGTTGGTAAGGATCTTTGG + Intronic
1133501805 16:6373448-6373470 GGATGGTTGGTTAGGATCTTTGG + Intronic
1135474793 16:22764625-22764647 GAGTGGTTGTTTTGGAAGCAAGG - Intergenic
1136529608 16:30859031-30859053 CACTGGTTGGTTTTGATCTTTGG - Intronic
1140855940 16:78977764-78977786 GAGTGCATGTTTGGGATCCTAGG - Intronic
1141535663 16:84678012-84678034 GCGTGGTTGGTTTCTCTCCTTGG + Intergenic
1146906414 17:36621188-36621210 GTGTGGCTGGCTTGGGTCCTTGG - Intergenic
1147445020 17:40469800-40469822 GAGCATTTGGTTTGGATCCTTGG + Intergenic
1148099331 17:45078752-45078774 GAGAGGTTGGCTTGAAGCCTGGG - Intronic
1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG + Intronic
1151883455 17:76909316-76909338 GAGAGGTTGGTTTGGTTAATGGG - Intronic
1155767012 18:29648731-29648753 TAGTGATTGGATTGGATCATGGG + Intergenic
1155864071 18:30942329-30942351 CAGTGGCTGGTCTGGAGCCTGGG + Intergenic
1156812447 18:41269087-41269109 GAGTGGCTGTGTTGGAGCCTGGG - Intergenic
1158395310 18:57074998-57075020 GAGAGGTTGCTTTTGTTCCTGGG + Intergenic
1158770759 18:60514377-60514399 GAGTTGTTGGTTTGAGTCATAGG - Intergenic
1160603415 18:80031866-80031888 GAGCAGCTGGTTTGGATTCTGGG + Intronic
1160914186 19:1488993-1489015 GAGGGGTTGGGATGGAGCCTGGG - Intronic
1161240892 19:3223212-3223234 GAGTGGTTGGTGTGCACCGTTGG - Intergenic
1162101048 19:8338983-8339005 GATTTGTTGATTTGGATCTTTGG - Intronic
1165046705 19:33110357-33110379 GAATGGATGGTTAGGATCTTCGG - Intronic
1167755579 19:51411233-51411255 GAGTGGATGATTTGGGTTCTGGG + Exonic
1167756583 19:51416789-51416811 AGGTCGTTGGTTTGGTTCCTTGG + Exonic
930116240 2:47720775-47720797 GAGTGGTTGGTGTTCTTCCTGGG - Intronic
930792136 2:55344680-55344702 GAGTGTTTTGTTTGCATTCTGGG - Intronic
932218712 2:69983855-69983877 TACTGGCTGGCTTGGATCCTGGG - Intergenic
932284516 2:70520940-70520962 GAGGGCTTGGCTTGGATACTGGG - Intronic
935302290 2:101703227-101703249 GAGAGGTTGGGGTGGATACTTGG + Intronic
936934033 2:117820602-117820624 GAGTGATTGGTTTACACCCTGGG + Intronic
938141144 2:128795475-128795497 GAGTGGTTGCTCTGGAACCTGGG + Intergenic
938702314 2:133890517-133890539 GAGGTGTTGGTTTGGCTCCCAGG + Intergenic
941163076 2:162056957-162056979 GACTGGTTGATTTAGTTCCTTGG - Intronic
941226570 2:162857155-162857177 TAGCCCTTGGTTTGGATCCTGGG - Intergenic
942456376 2:176140988-176141010 GAGGGGCTGGTTGGGATCCGCGG - Intergenic
943596759 2:189867224-189867246 GTGTGGTTGATTTGTACCCTAGG + Intronic
943628090 2:190221255-190221277 GAGTGCTGGGTTAGAATCCTAGG + Intronic
943731627 2:191308496-191308518 GAGGGGTTGAATGGGATCCTGGG - Intronic
945281493 2:208039696-208039718 CAGTGGTATGTTTGGTTCCTGGG + Intergenic
946401021 2:219468510-219468532 GAGTGGTGGGTTGGGATGCCTGG + Intronic
946713679 2:222531886-222531908 GAGTGGTTCATGTGGATGCTGGG - Intronic
947420240 2:229935685-229935707 TAGTGGATCTTTTGGATCCTTGG + Intronic
1170837245 20:19894999-19895021 GATTGGTGGGTTTGGACCCCAGG - Intronic
1170914482 20:20609507-20609529 GGTTGGTTGGTTTTGATCTTTGG - Intronic
1176272807 20:64245207-64245229 GGATGGTTATTTTGGATCCTGGG + Intergenic
1179562877 21:42227940-42227962 GAGAGGTGTGATTGGATCCTGGG - Intronic
1180642054 22:17306878-17306900 GACTGCCTGGTTTGAATCCTGGG + Intergenic
1182826970 22:33273908-33273930 AAGTGGTTGGTTTAGATCATCGG + Exonic
949200586 3:1373960-1373982 CAGTGGTTGGTTTGAGTCCTTGG + Exonic
952165432 3:30743655-30743677 GAGTGGATGGTTAGGAGCATGGG + Intronic
955830142 3:62992849-62992871 GAGAGGTTGGCTTGTTTCCTTGG + Intergenic
961567163 3:127772092-127772114 GAGTGCTTGGTTTGGGGCCTGGG - Intronic
961573297 3:127815947-127815969 GAATCGCTGCTTTGGATCCTGGG + Intronic
964988461 3:162774144-162774166 GAGTGGTTGCTTTGGATCCTGGG + Intergenic
968431600 4:562283-562305 GAGTTGTTGGTATGGAACCCTGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969458577 4:7315199-7315221 CAGAGGCTGGTTTGGAGCCTGGG - Intronic
974700569 4:65439470-65439492 GAGTGGTTGATTCTGATACTTGG - Intronic
978334226 4:107648521-107648543 CAGTGGTTGGGGTGGATACTGGG - Intronic
979846789 4:125523294-125523316 GGGTGGCTGGTTTTGATCATAGG - Intergenic
986370512 5:7075531-7075553 GAGATGTGGGTTTGGATCTTGGG - Intergenic
986795545 5:11207668-11207690 GAGTGGTGGGTTTGGAGTCCAGG - Intronic
988927214 5:36001714-36001736 AAATGGTTGGTTTGAATCTTTGG - Intergenic
993434238 5:87871916-87871938 GATTGATTGGTCTGGCTCCTTGG + Intergenic
995846868 5:116502862-116502884 GAGAGGTTGGTTGGCATTCTAGG + Intronic
999334467 5:150703738-150703760 GAGTGGTTGGTTTGGATCCTGGG - Intergenic
1005416381 6:25604570-25604592 GTGTGGCCGGTTTGGTTCCTCGG - Intronic
1007421258 6:41721028-41721050 GAATGGTTGGCCTGGGTCCTGGG - Intronic
1010259462 6:73798599-73798621 GAGCTGGTGGTTTGGATTCTCGG + Intronic
1010792326 6:80078669-80078691 GAGGATTTGGTTTGAATCCTTGG - Intergenic
1017032525 6:150236793-150236815 GAGTGGCTGATTTTGGTCCTGGG + Intronic
1017835000 6:158168660-158168682 GAGTGGTTTGTTTCCAGCCTAGG + Intronic
1018091991 6:160353671-160353693 CAGTGGTTGGTGTGCATTCTCGG + Intronic
1022827555 7:34031329-34031351 GAGGGGTTTGTTTGGAGGCTGGG - Intronic
1023708001 7:42962392-42962414 AAGTAGATGGTTTGGATCTTGGG + Intergenic
1025283282 7:57643440-57643462 GAGTGGTAGGTTAGGTTCTTAGG + Intergenic
1026664767 7:72332767-72332789 GAGTTGTCAGTTAGGATCCTTGG - Intronic
1028465551 7:91147710-91147732 AAGAGTTTGGTTTGAATCCTGGG - Intronic
1030936653 7:115593432-115593454 GAGTGGTGTGTTTGGAGCTTTGG + Intergenic
1036177228 8:6550425-6550447 GAGTGGTTGGCTTGGTGCCAGGG - Intronic
1036965386 8:13291739-13291761 GTTTGGTTGGTTTGGTTTCTAGG - Intronic
1039296043 8:36156124-36156146 GAATGATTGGGTTGGAACCTGGG + Intergenic
1039578675 8:38646182-38646204 GGGTGGTTGGGGTTGATCCTGGG + Intergenic
1043280695 8:78462014-78462036 CAGTGGTTGGTTGTGAACCTAGG + Intergenic
1044506455 8:93025571-93025593 AAGTGTATGGTTTGTATCCTCGG - Intergenic
1047622643 8:126623491-126623513 GAGTGATTGGTTTAGCTTCTGGG + Intergenic
1049208341 8:141373777-141373799 TAGAGGCTGGTTTGGATCCGTGG - Intergenic
1049243187 8:141549029-141549051 GTGGAGTAGGTTTGGATCCTGGG + Intergenic
1049309778 8:141927671-141927693 GAGTGGTGGGTTTGAGTCCCTGG - Intergenic
1051698027 9:19789487-19789509 GAGTGTTGGATTTGGATGCTTGG + Intergenic
1056028056 9:82521457-82521479 GAATGGTTGGTTTGGACTCCTGG - Intergenic
1062501648 9:136854411-136854433 GAGGGGGTGCCTTGGATCCTTGG + Intronic
1186741026 X:12518024-12518046 GACTGGATGGTTTGGACCCAGGG - Intronic
1189827020 X:44929663-44929685 GAGTGGTTGGATTGTATGGTGGG + Intronic
1192025985 X:67452261-67452283 GAGTGGATGGCTTGGAGCCCAGG + Intergenic
1192658250 X:73015062-73015084 AAGTGGTTGGTTTGGGTCCTGGG - Intergenic
1193115703 X:77773292-77773314 GGGTGGTTGGTTTTGAACTTTGG + Intronic
1193294582 X:79819767-79819789 GAGTGGTTGGTTTGAATCCTGGG - Intergenic
1193641516 X:84014602-84014624 GAGCAGTTGGTTTGAACCCTGGG + Intergenic
1193693629 X:84680094-84680116 TAGTGATTACTTTGGATCCTGGG + Intergenic
1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG + Intergenic
1196557133 X:117101006-117101028 GATTGACTGGTCTGGATCCTAGG - Intergenic
1196832051 X:119783463-119783485 GAGGGGTTTATTTGGAGCCTGGG - Intergenic
1198022415 X:132671892-132671914 TTGTGGCTGGCTTGGATCCTCGG + Intronic
1201518094 Y:14840409-14840431 AACTGGTTGGTTTGGATCACTGG - Exonic