ID: 1065571107

View in Genome Browser
Species Human (GRCh38)
Location 10:27071939-27071961
Sequence CTACCTCACAGGCGTCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065571099_1065571107 17 Left 1065571099 10:27071899-27071921 CCCTGACTCCAGGAGGGACAGAG 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1065571107 10:27071939-27071961 CTACCTCACAGGCGTCCTGCCGG No data
1065571100_1065571107 16 Left 1065571100 10:27071900-27071922 CCTGACTCCAGGAGGGACAGAGG 0: 1
1: 0
2: 10
3: 51
4: 398
Right 1065571107 10:27071939-27071961 CTACCTCACAGGCGTCCTGCCGG No data
1065571103_1065571107 9 Left 1065571103 10:27071907-27071929 CCAGGAGGGACAGAGGGAAGCCA No data
Right 1065571107 10:27071939-27071961 CTACCTCACAGGCGTCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065571107 Original CRISPR CTACCTCACAGGCGTCCTGC CGG Intronic
No off target data available for this crispr