ID: 1065571172

View in Genome Browser
Species Human (GRCh38)
Location 10:27072310-27072332
Sequence AAGAATCCACAGAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065571172_1065571175 -9 Left 1065571172 10:27072310-27072332 CCCAGCTCCTTCTGTGGATTCTT 0: 1
1: 1
2: 2
3: 23
4: 333
Right 1065571175 10:27072324-27072346 TGGATTCTTTTGTGCAGCAGAGG No data
1065571172_1065571176 10 Left 1065571172 10:27072310-27072332 CCCAGCTCCTTCTGTGGATTCTT 0: 1
1: 1
2: 2
3: 23
4: 333
Right 1065571176 10:27072343-27072365 GAGGCAGCTGAGCTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065571172 Original CRISPR AAGAATCCACAGAAGGAGCT GGG (reversed) Intronic
900217125 1:1487505-1487527 AAGAGTCCACGCAAGGAGCAGGG - Intronic
902048761 1:13545265-13545287 ATGAACTCACAGAAGGTGCTGGG - Intergenic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
903259517 1:22123859-22123881 AAGAACCCACAGAGGGAATTGGG - Intronic
903314546 1:22491516-22491538 AAAGGTCCACAGAAGGAGGTAGG + Exonic
903826510 1:26149402-26149424 GGGAATCCACAGAAGGATCGGGG + Intergenic
903943322 1:26946390-26946412 GAGAGGACACAGAAGGAGCTGGG - Exonic
904375661 1:30080657-30080679 TAGAAACCAGAGATGGAGCTAGG - Intergenic
904947606 1:34210945-34210967 AAAAATCCACAAAGGGGGCTGGG - Intronic
906804538 1:48767645-48767667 AAGAAACCACAGAAGAAACTAGG + Intronic
906972799 1:50534567-50534589 AAAAATCAACAGAAGAGGCTGGG - Intronic
908783931 1:67716653-67716675 AAGAATACAAGGAAGGGGCTGGG + Intronic
908813891 1:68011964-68011986 AAGACTTCACAGAAGGGGGTTGG - Intergenic
911756366 1:101561200-101561222 AAAAGTACACAGAAAGAGCTGGG - Intergenic
912125395 1:106531093-106531115 AAGCATCCACATAAGAAACTAGG + Intergenic
912568763 1:110607021-110607043 AAGAGTGCACAGAATGGGCTCGG - Intronic
912925104 1:113906375-113906397 AAGAATCCACCTAATGTGCTGGG + Intronic
913206226 1:116541748-116541770 AGGTATACACATAAGGAGCTCGG + Intronic
913299126 1:117352226-117352248 AAAAATACACAGAATTAGCTGGG - Intergenic
914898677 1:151699253-151699275 AAGAAGCCACAGGAGGCCCTTGG + Intergenic
915390475 1:155538801-155538823 AAGAATCTAGAGTAGGAGCCAGG - Intronic
915847459 1:159282367-159282389 AGGATTCCACAGAAGGAAGTTGG - Intergenic
916638526 1:166700563-166700585 AAGATTTCACAGAAGAAACTTGG - Intergenic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
918277592 1:182968421-182968443 ACGAATCCACAGAAAAAGATGGG - Intergenic
918378548 1:183932844-183932866 AAAAATCCACCCAAGGAGGTGGG - Intronic
919101878 1:193105639-193105661 AAGAATCCAGAGGCGGGGCTCGG - Exonic
919130962 1:193449853-193449875 AAGAGTCCTCTCAAGGAGCTTGG - Intergenic
920857706 1:209676185-209676207 AAGCATCCACCAAAGGAGTTTGG + Exonic
922663601 1:227450596-227450618 AAGAGTCCACACAAGGAGAGAGG - Intergenic
924054150 1:240108738-240108760 AAAAATGCACAGAAGGGGCCTGG + Intronic
1063041472 10:2342735-2342757 CAGAAGCCAAACAAGGAGCTAGG + Intergenic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1065351355 10:24798260-24798282 TACAATCCACAGATGGTGCTGGG - Intergenic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1069300028 10:66895934-66895956 AAGAACACACAGAATTAGCTGGG + Intronic
1069467043 10:68650344-68650366 AAGAAGCCACAGAAGTAGGCTGG + Intronic
1069487435 10:68833063-68833085 AAAAACCCACAGAAGTGGCTAGG - Intronic
1069570166 10:69489922-69489944 AAGAAGCCCCAGAACAAGCTGGG - Intronic
1071973662 10:90933466-90933488 AAAAAGCCACAGAAGGTTCTTGG + Intergenic
1071983848 10:91031318-91031340 CAGAGGCCACAGAAGCAGCTGGG - Intergenic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072764512 10:98084604-98084626 AAGAAGCCACAGAAGGCTTTGGG + Intergenic
1074258593 10:111829169-111829191 ATGAAACCTCAGAAGGAACTTGG - Intergenic
1075585720 10:123656692-123656714 AAGATGCCACACAAGGAACTTGG - Intergenic
1076257341 10:129038158-129038180 AATAATGTACACAAGGAGCTTGG + Intergenic
1076444200 10:130500699-130500721 GAGAATCCACAGACAGTGCTGGG + Intergenic
1077431722 11:2518975-2518997 CACAAACCACAGAAGGAGCGTGG - Intronic
1079102853 11:17552374-17552396 AAGAAGCCACAGAACCAGGTGGG - Intronic
1080584674 11:33670809-33670831 CAGAAGCCACAAAAGGACCTTGG + Exonic
1081432663 11:42993500-42993522 AAGAATACAAAGAATTAGCTGGG - Intergenic
1081590651 11:44420748-44420770 AAGAAATCACAGAAGGCTCTGGG - Intergenic
1082786734 11:57321442-57321464 AAGAGTCTACACAAGGAGCCAGG + Intronic
1084739023 11:71126566-71126588 CAGATTCCTCAGATGGAGCTGGG + Intronic
1089390744 11:118099911-118099933 AAGATTCAACTGAAGGAGCAGGG + Intronic
1090901561 11:131036965-131036987 AGGAACCAACAGAAGGATCTTGG + Intergenic
1091774770 12:3177296-3177318 AAAAATACACAGAATTAGCTGGG - Intronic
1092536943 12:9398044-9398066 CAAAGTCCACAGAAGTAGCTTGG + Intergenic
1093275000 12:17115024-17115046 AAGAATTAAAAGAAGGAGCTTGG + Intergenic
1093424769 12:19016001-19016023 AAAAATACACAGAATTAGCTGGG + Intergenic
1094399292 12:30044389-30044411 TGGAAACCACAGAAGGAGCACGG + Intergenic
1094513559 12:31112642-31112664 CAAAGTCCACAGAAGTAGCTTGG + Intergenic
1095046112 12:37508251-37508273 AAGAATCCTGAGAAAGAACTAGG + Intergenic
1095377228 12:41544921-41544943 AAGAAGCCACAGAGAGAACTTGG - Intronic
1096614324 12:52823157-52823179 AAGGATGCTCAGAAGAAGCTTGG - Exonic
1096848133 12:54419011-54419033 GAGAATCCGAAGAAGGAGCCCGG + Exonic
1098029660 12:66240723-66240745 AGGACTCCACAGAAGGACCTGGG - Intronic
1098394107 12:70000272-70000294 AAGCATCCAGAGAAGGAGAGAGG - Intergenic
1098755690 12:74360634-74360656 AAGACTCCAAAGAATGAGTTAGG - Intergenic
1100267884 12:92995664-92995686 AAGAATCCACTGAAAGCCCTTGG - Intergenic
1100775037 12:97964550-97964572 AAGAATGAACAGGAGAAGCTTGG - Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1102295523 12:111733669-111733691 AAGGCTGCAGAGAAGGAGCTGGG + Intronic
1102606803 12:114073980-114074002 AAGATTCCTCAGGAGGGGCTGGG - Intergenic
1104075759 12:125388266-125388288 AAAAATACACAAAAGTAGCTGGG + Intronic
1104437321 12:128766401-128766423 AAAAACACACAGAAAGAGCTGGG + Intergenic
1106512649 13:30424633-30424655 AATAATCCACAGAGGTAGTTTGG - Intergenic
1107177182 13:37412254-37412276 AAGAATCCACAAATGAGGCTGGG + Intergenic
1107403307 13:40090286-40090308 TAGAAGTGACAGAAGGAGCTGGG - Intergenic
1107917323 13:45166107-45166129 AAGAATGTACTGAAGTAGCTGGG - Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1111051661 13:82890171-82890193 AGGAATACACAGACGGAGGTAGG - Intergenic
1111155517 13:84318083-84318105 AAGAAGCCAGAGAATGAACTAGG + Intergenic
1112074643 13:95898342-95898364 GAGAAGCCAGAGAAGTAGCTGGG - Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113932047 13:113973807-113973829 AGGAAGCCTCACAAGGAGCTGGG - Intergenic
1114179548 14:20354289-20354311 AAGTATCCATTAAAGGAGCTAGG - Intronic
1115542850 14:34438966-34438988 TAGGATCCACAGAAGTAGATAGG + Intronic
1115994484 14:39181638-39181660 TAGAAAGCACAGAAGGAGCGTGG + Exonic
1116456081 14:45122662-45122684 AAAAATCCAAAAAATGAGCTGGG - Intronic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1116975201 14:51108312-51108334 AGGATTCAAAAGAAGGAGCTGGG + Intergenic
1119261544 14:73240859-73240881 TAGAAGCCACAGAGGCAGCTGGG + Intronic
1120878907 14:89399322-89399344 AAGAGCACACAGAGGGAGCTGGG + Intronic
1121530983 14:94653356-94653378 AAGAATTCACAGCAGGATCTAGG + Intergenic
1121952645 14:98185084-98185106 AAAAAGCCACAGAAGGCCCTGGG + Intergenic
1121965653 14:98302057-98302079 CAGAAACCACGGAAGGAGCCGGG - Intergenic
1124782827 15:32652025-32652047 AAGAATCCACAAAGGAAACTGGG + Intronic
1125128167 15:36249212-36249234 AAGAATATACAGAAGAAGATAGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125851144 15:42904036-42904058 AACAATCATCAGAATGAGCTTGG + Intronic
1126436228 15:48641214-48641236 AAGAAAACACAGCAGAAGCTGGG + Intronic
1126687313 15:51259678-51259700 ATGAGTCCAAAGAAGGTGCTAGG + Intronic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128535599 15:68487614-68487636 AAGCATCCACAAAACAAGCTTGG + Intergenic
1128939059 15:71772085-71772107 AAGAAGCTACTGAAGGGGCTCGG - Intronic
1129300222 15:74621126-74621148 AAGAAGTCACAGAAAGCGCTGGG - Intronic
1130770886 15:86922449-86922471 AAAAATACACAGAATTAGCTGGG - Intronic
1131379576 15:91953011-91953033 AAGAATCCCAAGAAGTAGATAGG + Intronic
1132407252 15:101551363-101551385 AAGAATCCACAGATGGCTCCTGG + Intergenic
1135724102 16:24841199-24841221 AAGAACCCAGAGATGGGGCTGGG - Intergenic
1136286124 16:29243574-29243596 AAGAACCCCCAGAAAGAGCAAGG - Intergenic
1136667093 16:31821330-31821352 AGGACTCCACAGAACGAGCAGGG - Intergenic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1140345110 16:74205945-74205967 AAGGAGCCAAAGAAAGAGCTGGG + Intergenic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1141498077 16:84423951-84423973 AAGAAGCCCCAGAAGGGACTGGG - Intronic
1146829315 17:36054479-36054501 AAGAATACACAAAATGGGCTGGG + Intergenic
1147363116 17:39943837-39943859 AAGACTCCCCAGAGGGACCTCGG + Intronic
1147771584 17:42871942-42871964 ATGAATACACAGAAGGCACTCGG + Intergenic
1150484571 17:65534767-65534789 AACAATACAAAAAAGGAGCTGGG + Intronic
1152290208 17:79436070-79436092 AAGAATCCACACATGGGCCTGGG - Intronic
1152734039 17:81988163-81988185 AAGAAACAACAGAAGTGGCTGGG + Intronic
1152769159 17:82156960-82156982 ATGAATCCACAGAAGGTTTTGGG - Intronic
1154138103 18:11798488-11798510 AAGAATTCAGAGAATGAGCTGGG - Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1155248961 18:23937666-23937688 AAGACTCCAGAGAGGGAGCAAGG + Intronic
1156049492 18:32915128-32915150 AAGCATAGACAGAAGGACCTGGG + Intergenic
1159460516 18:68716915-68716937 AAGAATACAGAGAATTAGCTGGG + Intronic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1159848396 18:73494955-73494977 AAGAATGTACAGAAGAAGCTAGG + Intergenic
1162154946 19:8671315-8671337 AAGAAAACACAGTAAGAGCTGGG - Intergenic
1162707413 19:12565507-12565529 AAGAATACAAAAAAGTAGCTAGG - Intronic
1163229720 19:15993035-15993057 ATGAATCCAAAGAAGTAGGTTGG - Intergenic
1163705015 19:18807523-18807545 AAGAGGCCACAGAGGGTGCTCGG + Intergenic
1164258007 19:23546153-23546175 AAGAATCCACAGAAGTACAAAGG - Intronic
1165832566 19:38736761-38736783 AAGGATACAGAGAAGGCGCTGGG - Intronic
1166096187 19:40540932-40540954 GAGCAGCCACAGAAGGACCTGGG - Intronic
1168607388 19:57770775-57770797 CAGAATCCACAGTAGGAAGTAGG + Intronic
1168673614 19:58260236-58260258 AGAAATCCACAGAATGAACTGGG - Intronic
925024881 2:599815-599837 CAGAGTCCACAGCAGGACCTGGG - Intergenic
925079752 2:1054487-1054509 ACAAAACCACAGTAGGAGCTTGG - Intronic
925254813 2:2474430-2474452 AAGAATACAGGGGAGGAGCTTGG - Intergenic
926009667 2:9398212-9398234 TAGAATCCACAAAACCAGCTGGG + Intronic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926764877 2:16315406-16315428 AAGAATCAACAGCAGCAGCTTGG + Intergenic
927247253 2:20967350-20967372 AACAAACCACAGGTGGAGCTGGG - Intergenic
928731903 2:34241105-34241127 AAGAATCCTCTGGAGTAGCTGGG - Intergenic
928820521 2:35355940-35355962 AAAAATCCAAAAAAGTAGCTGGG - Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
931635210 2:64334349-64334371 AAGAATGGACAGAAGAGGCTTGG - Intergenic
931821909 2:65960757-65960779 AAGAAACCACAGAATCAGATTGG + Intergenic
931972878 2:67609414-67609436 AGCAAACCACAAAAGGAGCTGGG - Intergenic
931989731 2:67777911-67777933 AAGAATCCACCGAAGGATCATGG + Intergenic
932852058 2:75197393-75197415 AGAAACCCAAAGAAGGAGCTAGG - Intronic
933587617 2:84196338-84196360 AACAATGCACAGAAGGAATTAGG - Intergenic
934133367 2:88970755-88970777 ATGAATTCAGAGAAGGAGGTGGG + Intergenic
934220207 2:90075353-90075375 ATGAATTCAGAGAAGGAGGTGGG - Intergenic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
938769318 2:134487077-134487099 AAGAACCAACAGAAGGATATAGG + Intronic
938926941 2:136052101-136052123 TGGAATACACAGAGGGAGCTGGG + Intergenic
942687818 2:178552304-178552326 AAGAATGCCAAGAAGGAGCATGG - Exonic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
944996353 2:205298887-205298909 AAGCATCCAGACCAGGAGCTGGG - Intronic
945408011 2:209473437-209473459 AAGAGTCTACAGCAGGACCTAGG + Intronic
945470831 2:210225897-210225919 AAGAATTAACAGAACGGGCTGGG - Intergenic
947366936 2:229406276-229406298 AAGTACCCACAGAAGAAGGTGGG - Intronic
948122775 2:235543476-235543498 GAGCATCCAGAGAAGAAGCTGGG + Intronic
948150749 2:235742869-235742891 AAAAATCTACAGAAGAGGCTAGG + Intronic
948845067 2:240679191-240679213 AAGGATCCGCAGGAGGAGCGTGG + Intronic
948848793 2:240695688-240695710 AAGGATCCGCAGGAGGAGCGTGG - Intronic
1168853126 20:990070-990092 AAGCATTCACAGGAGGAGCCAGG + Intronic
1169253299 20:4077090-4077112 AAGAAACCAAAGAAGGAGGCAGG - Intergenic
1169746937 20:8952220-8952242 GAGAAACCACAAAAGGAGTTGGG - Intronic
1171156521 20:22879515-22879537 AAGTATCCACAGAAAGAGTTAGG + Intergenic
1173080982 20:39867290-39867312 AAGAAATCACAGAAGAGGCTGGG + Intergenic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1173828868 20:46065451-46065473 GAGAATCAAGAGAAGGACCTGGG - Intronic
1174232541 20:49058064-49058086 AAGAAGCCCCATAAGGAGCCCGG - Intronic
1174302771 20:49594292-49594314 CAGAAACCACCGAGGGAGCTGGG + Intergenic
1174327430 20:49790473-49790495 AAGAATCCGAGGAAGGAACTGGG - Intergenic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1175289106 20:57861907-57861929 TAGACTCCCCAGAAGGATCTTGG + Intergenic
1175741641 20:61423825-61423847 TAGAAGCCACTGAAGAAGCTTGG - Intronic
1177238484 21:18424647-18424669 AAGAACCGACAAAAGGAGCCGGG + Intronic
1178870300 21:36368340-36368362 AAGAATACAAAGAAGGGGCCGGG + Intronic
1180126577 21:45794766-45794788 AAAAATACACAGAATGAGCCGGG + Intronic
1182176864 22:28299095-28299117 AAGAATTGGGAGAAGGAGCTTGG - Intronic
1182772644 22:32806289-32806311 AAGTGGCCACAGAAGTAGCTTGG + Intronic
1182926574 22:34130807-34130829 AAGAATCTACAGAATGGGCCGGG + Intergenic
1183051843 22:35269079-35269101 TAGAATTCATAGAAGGAGCTGGG + Intronic
1183167086 22:36156074-36156096 AAGATTCCTCAGGAGGAGCACGG - Intronic
1183468870 22:37995082-37995104 AAGATCACACAGCAGGAGCTGGG - Intronic
1183890923 22:40927926-40927948 AAGAATCTATAGAGGGAGCAGGG - Exonic
950325112 3:12100391-12100413 AAGAGTCAACAAAAGGTGCTGGG + Intronic
950629362 3:14271983-14272005 AAGAAAATACAGAAGGCGCTGGG - Intergenic
952145596 3:30528546-30528568 AAGAATTCTGAGAAGGAGATAGG - Intergenic
952209992 3:31220815-31220837 AAGAATTCAAAGCAGGAACTTGG + Intergenic
953095600 3:39771912-39771934 AGGAATACACAGAAGGAGTGTGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953323990 3:41996954-41996976 AAGAATACACAGTAGGAGCCAGG - Intergenic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
954568732 3:51622753-51622775 CAGCATCCAGAGAAGGATCTTGG + Intronic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
957037462 3:75307851-75307873 AAGAATTCAAAGGAGGGGCTGGG - Intergenic
957263150 3:77926038-77926060 CAGAATCCAGAGAACTAGCTAGG + Intergenic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
959241824 3:103806850-103806872 AAGAATCCAGAGAAAAAACTAGG - Intergenic
959532659 3:107451360-107451382 AAGACTCCCCAGAACCAGCTGGG + Intergenic
959921390 3:111872169-111872191 ATGTATCCACAGAATGGGCTGGG - Intronic
961049024 3:123731039-123731061 AAGAAGCCACAGGAGAATCTAGG + Intronic
961090889 3:124111926-124111948 ATGATTCCACTGAATGAGCTGGG + Intronic
961111164 3:124284311-124284333 AAGAAGCCATAGTAGGAGATAGG - Intronic
962060329 3:131920085-131920107 ATGAATCCACAGAAGGATGTTGG - Intronic
962896382 3:139718620-139718642 AAGAACCAGCAGAGGGAGCTTGG + Intergenic
963234940 3:142947307-142947329 AAGAAGCCACAGGAGGAGGAAGG + Intergenic
963666335 3:148192455-148192477 AGGAAGCCACAGTATGAGCTGGG + Intergenic
966378034 3:179317049-179317071 AAAAATACAAAGAAGTAGCTGGG - Intergenic
966638746 3:182164868-182164890 CAGATACCAAAGAAGGAGCTGGG - Intergenic
966669695 3:182513313-182513335 AAAAATCCATAGAAGAGGCTGGG - Intergenic
967225750 3:187289462-187289484 AAGAGCTCACAGAAGAAGCTGGG + Intronic
967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968223848 3:196959822-196959844 AAGACACCCTAGAAGGAGCTAGG - Intronic
969971395 4:11052050-11052072 AAGAATGAACAGAACGAGGTAGG - Intergenic
970083591 4:12319521-12319543 AAGAAGCCAGAGAAATAGCTAGG - Intergenic
970142302 4:12995939-12995961 TAGTATCCTCAGAAAGAGCTAGG - Intergenic
971052893 4:22881123-22881145 AAGAATCCACAAAAACAGCAGGG - Intergenic
971089308 4:23321915-23321937 ATGAATCCACAGAAAGTGTTAGG + Intergenic
971703817 4:30013648-30013670 AAGAAGCTACAGCATGAGCTGGG - Intergenic
973830793 4:54756911-54756933 AAGAAGCCACAGAAAGACCTGGG + Intergenic
974628663 4:64455563-64455585 AAGGACCTACAGAAGAAGCTGGG - Intergenic
975198495 4:71555530-71555552 AAGAACACACAGAAAGAGTTAGG - Intronic
975603157 4:76125128-76125150 AAAAATACAAAGAAGTAGCTGGG + Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
978185972 4:105857762-105857784 AAGCTTCCAGAGAAGGAGCAGGG - Intronic
978524433 4:109651187-109651209 TATAATCCACTGAAGGAGATAGG - Intronic
979009482 4:115349427-115349449 AAGACTCCACAGAACGTTCTTGG - Intergenic
979976472 4:127202610-127202632 AAGATTTCACAGGAGGAACTGGG - Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
992087444 5:73290540-73290562 AAGAACCTACAGAAGGAGCAGGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994308230 5:98234537-98234559 AAGAATTCAGTGAAGTAGCTGGG + Intergenic
996157934 5:120126670-120126692 AAGAATGGATAGAAGGAGATGGG + Intergenic
997715123 5:136036815-136036837 AAGACTCCAGAGAAGGAGGCTGG + Intronic
998180081 5:139930879-139930901 AAGAATCCACAGATTTATCTGGG + Intronic
998225960 5:140326412-140326434 AAGAAGCAAGACAAGGAGCTGGG - Intergenic
999573449 5:152946766-152946788 GAGATTCCTCAGAAGGAGTTTGG + Intergenic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
1000472608 5:161664395-161664417 AAGATTCCACAGAAAGTACTTGG - Intronic
1001250840 5:170145701-170145723 AAGTATCCTTAAAAGGAGCTAGG + Intergenic
1001528412 5:172445367-172445389 AAAAATCCACAAAATTAGCTGGG - Intronic
1001986414 5:176077076-176077098 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002230453 5:177761049-177761071 CTGAATCCACAGCAGGAGGTTGG + Intronic
1002264883 5:178022698-178022720 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002468206 5:179418480-179418502 AAAAATACAAAGAAGTAGCTGGG + Intergenic
1002779358 6:354400-354422 AAGATGCTACAGAAGGGGCTGGG + Intergenic
1002904224 6:1435850-1435872 AAGAATTCACAGCAGGGTCTTGG + Intergenic
1003252979 6:4448214-4448236 AAGATCCCAGAGAAGGAGGTGGG - Intergenic
1003850547 6:10218099-10218121 CAGAAGCCACAGAAAGAACTGGG - Intergenic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004999461 6:21226036-21226058 GAGAATCCTCAGATGGAGCTGGG + Intronic
1005601694 6:27432621-27432643 AGGAAACCACAGAAAGATCTGGG - Intergenic
1005725886 6:28648283-28648305 AAGAAGCCACAGAATCAGCACGG - Intergenic
1006054981 6:31377598-31377620 AATAATCCCCAAAAGGACCTGGG - Intergenic
1007357735 6:41333412-41333434 AGGAACCCAGAGAAGGAGCTGGG - Intergenic
1007642680 6:43355227-43355249 AAGGATCCACAGGAGAAGGTGGG + Exonic
1009295999 6:61948478-61948500 AAGAATCAAAAGAATGAGTTTGG + Intronic
1012072948 6:94646127-94646149 AACAATCCCCAGATGGATCTAGG + Intergenic
1012468976 6:99548516-99548538 AAAAATCAATAGAAGGGGCTGGG + Intronic
1013031632 6:106339436-106339458 AAGACTCCACAGAGGGGCCTCGG - Intergenic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1016200540 6:141402228-141402250 AAGAATCAAAAGAAAGAGATTGG + Intergenic
1016331148 6:142952973-142952995 AAGAAACCACTGCAAGAGCTTGG - Intergenic
1016734171 6:147458197-147458219 AAGAAGAGACAGAAGGAACTGGG - Intergenic
1018028433 6:159823205-159823227 CAGAATCCACAGAAGGAGCTTGG - Intergenic
1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG + Intergenic
1020305586 7:6831612-6831634 AAAAATGCAAAGAATGAGCTGGG - Intergenic
1021351958 7:19604688-19604710 AAGAATCCAGAGAAAGAGATTGG - Intergenic
1022595221 7:31707047-31707069 ACCAACCCAGAGAAGGAGCTGGG - Intronic
1023226934 7:37979887-37979909 AAGAACTCAGAGAAGGAGCCAGG - Intronic
1023956123 7:44888148-44888170 AAGAAACCAGAGAAGGAGCTGGG - Intergenic
1024815166 7:53260511-53260533 AAAAATCGAAAGAAGGAACTTGG - Intergenic
1025076438 7:55947759-55947781 AAAAATACACAAAAGTAGCTGGG - Intergenic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1028403215 7:90446847-90446869 AAGGATTCACAGTAGGAGATTGG - Intronic
1028473765 7:91232101-91232123 AAGTATCCACTGAAGTAGATAGG - Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1032921122 7:136549383-136549405 AAGAATCCTCAGAGGCAGATAGG - Intergenic
1033028801 7:137804986-137805008 GAGAAACCCCAGAAGCAGCTGGG + Intronic
1034586507 7:152098320-152098342 AACAATCCTCATAAGTAGCTGGG - Intronic
1034864410 7:154628656-154628678 AACTATCCAAAGAAGGATCTGGG + Intronic
1034984182 7:155497227-155497249 CAGAATCCTGAGAAGGGGCTGGG - Intronic
1036076259 8:5504502-5504524 AAAAATACACAAAAGTAGCTCGG - Intergenic
1036571623 8:9984824-9984846 AAGACTCAACACAAGGAGCCAGG + Intergenic
1037087158 8:14866647-14866669 AAAAATACAAAGAATGAGCTGGG + Intronic
1038288093 8:26224291-26224313 AAAAATCCAGAAAAGGGGCTGGG + Intergenic
1040530951 8:48265884-48265906 AAGAATATGCAGAAGGGGCTGGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041680016 8:60579336-60579358 AAAAATCCACAGGATTAGCTGGG - Intronic
1041783256 8:61602091-61602113 CAGACCCCACAGAAGGAGTTGGG - Intronic
1042522133 8:69724802-69724824 AAGAGGCCGCAGCAGGAGCTGGG + Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1044173257 8:89083102-89083124 AAGAATCCAAAAATGGGGCTGGG + Intergenic
1044841236 8:96338807-96338829 AAGAATCCAGGGGAGGAGCCTGG - Intergenic
1044923851 8:97192972-97192994 AGGTTTCCACAGAAAGAGCTGGG + Intergenic
1045449096 8:102302175-102302197 AAGAATCTATATGAGGAGCTGGG - Intronic
1046844728 8:118903157-118903179 AAGAATCCACAGAGGAAGTCAGG - Intergenic
1047342366 8:123994428-123994450 AAGAGTCCAGAGAAGGAGTGGGG + Intronic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1047689739 8:127339633-127339655 AGGAATGTACAGATGGAGCTAGG + Intergenic
1048091357 8:131243936-131243958 CAGAATCCACAGCAGGAGCTTGG + Intergenic
1048241686 8:132748973-132748995 AAGATTCCAGAGCAGGAGTTTGG + Intronic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1051435465 9:17026461-17026483 AATAATCCACCAAAGGACCTTGG + Intergenic
1052404998 9:28048227-28048249 AATAATCCACAGAAGAAACTCGG + Intronic
1052657292 9:31378879-31378901 AAAAATCCAAAAAAGTAGCTGGG - Intergenic
1053558866 9:39168310-39168332 AAGAATTCAAAGAAGGGGCCAGG - Intronic
1053822990 9:41988543-41988565 AAGAATTCAAAGAAGGGGCCAGG - Intronic
1053910724 9:42900138-42900160 AAGAATACACAAAATTAGCTGGG + Intergenic
1054138245 9:61450633-61450655 AAGAATTCAAAGAAGGGGCCAGG + Intergenic
1054607583 9:67198823-67198845 AAGAATTCAAAGAAGGGGCCAGG + Intergenic
1056020930 9:82437687-82437709 AAGAATCCAAAAAATTAGCTGGG + Intergenic
1056429773 9:86515588-86515610 AAAAATACACAAAAGAAGCTTGG - Intergenic
1057055038 9:91953937-91953959 CTGAATCCACACAAGCAGCTGGG + Intergenic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059029743 9:110678347-110678369 AAGGATCCACTGAAGGATCCAGG - Intronic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1061287165 9:129630617-129630639 AAGAGTCCACATATGGAACTCGG - Intronic
1186105996 X:6206581-6206603 AAGAACCCTCAGAGGGAGCATGG - Intronic
1186658716 X:11645705-11645727 AAGACTGCAAAGAAGAAGCTTGG + Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187562354 X:20414743-20414765 CAGAATCCACAGGATGAGCATGG - Intergenic
1188084699 X:25889181-25889203 AAGAATCCACTGAAATAACTTGG - Intergenic
1188161858 X:26814464-26814486 AATAATCCACAGTGGTAGCTAGG - Intergenic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1189951405 X:46235086-46235108 TGGAATTCTCAGAAGGAGCTAGG + Intergenic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190969776 X:55337252-55337274 ATGTATCCACAGAAGTAGTTTGG - Intergenic
1191943118 X:66501082-66501104 AAGAATGCCCATATGGAGCTTGG + Intergenic
1192682272 X:73264125-73264147 AGGGATCCACAGCAGCAGCTGGG + Intergenic
1193492546 X:82166966-82166988 AAGAATGAACAGAAGAGGCTGGG + Intergenic
1194430285 X:93795075-93795097 AAGAAAGATCAGAAGGAGCTGGG + Intergenic
1194727981 X:97420759-97420781 TAGAATCCACAGGATGAGCTAGG - Intronic
1195385201 X:104307563-104307585 AAGAATTCAGAGAAGAAGCGGGG + Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1199159222 X:144587602-144587624 AAGAATCCACACAGGGAGCAGGG + Intergenic
1200622016 Y:5461917-5461939 TAGATTCCACAGAAATAGCTGGG + Intronic
1200754416 Y:6976952-6976974 AAGAAGCAACACAGGGAGCTTGG - Intronic