ID: 1065571347

View in Genome Browser
Species Human (GRCh38)
Location 10:27073305-27073327
Sequence CACGCACATCATGCTGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065571347_1065571353 28 Left 1065571347 10:27073305-27073327 CCCACGACAGCATGATGTGCGTG 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1065571353 10:27073356-27073378 TCAGGGTGACTGCATCCCACAGG No data
1065571347_1065571350 11 Left 1065571347 10:27073305-27073327 CCCACGACAGCATGATGTGCGTG 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1065571350 10:27073339-27073361 AGCCTTCCTGAAGCACTTCAGGG No data
1065571347_1065571349 10 Left 1065571347 10:27073305-27073327 CCCACGACAGCATGATGTGCGTG 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1065571349 10:27073338-27073360 CAGCCTTCCTGAAGCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065571347 Original CRISPR CACGCACATCATGCTGTCGT GGG (reversed) Intronic
902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG + Intronic
905435006 1:37950026-37950048 CACACACATCATGCTCTCCCTGG - Intergenic
906514810 1:46432619-46432641 CAGGCTCACCATGCTGTCATAGG - Intergenic
914577151 1:148983609-148983631 CACAGAGATCATGCTGTGGTTGG + Intronic
919498550 1:198308779-198308801 CACACACATCATACTTTCTTTGG + Intronic
921693160 1:218176606-218176628 CACTCACATCATGCGGTCTCAGG - Intergenic
923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG + Intronic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1075838786 10:125479430-125479452 CACGCACATCCTGCAGTTCTTGG - Intergenic
1076093589 10:127711902-127711924 CAAGCACCTCATGTTCTCGTGGG + Intergenic
1076319112 10:129565046-129565068 CACGCACATTCTGCCGTCTTGGG + Intronic
1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG + Intronic
1111637878 13:90928907-90928929 CAGGCACATCCTACTGTCTTGGG + Intergenic
1116873335 14:50088563-50088585 TACGCACATCATGGGGTTGTTGG - Intronic
1129955383 15:79631475-79631497 CATGCACATCATGCTTCTGTTGG - Intergenic
1137628968 16:49928612-49928634 CATGCACGTGATGCTATCGTTGG - Intergenic
1140271943 16:73473937-73473959 CAAGCAAATAATGCTGTCATCGG - Intergenic
1143137877 17:4722013-4722035 CAAGAACGTCATGCTGCCGTGGG + Intergenic
1145030056 17:19497989-19498011 CACTCACACCATGGTGTCTTTGG + Intronic
1149867561 17:60159139-60159161 CAGGCACCTCATCCTGTCCTGGG - Intronic
1151644194 17:75418687-75418709 CACACAAAACATGCTGTAGTTGG - Intergenic
1158847287 18:61458004-61458026 CACACACATTATGCTGTAGATGG - Intronic
1166455395 19:42936249-42936271 CACGGAGCTCATGCTGTCATGGG - Intronic
1166827103 19:45616512-45616534 CACGTACACCAAGTTGTCGTGGG + Exonic
926104399 2:10141397-10141419 CACGCATCTCATGCTGTGCTAGG + Exonic
945179379 2:207076168-207076190 CACCCTCATTATGCTGACGTGGG + Exonic
947432929 2:230046444-230046466 CACGCACATCTTTCTCTCCTGGG + Exonic
949038462 2:241832562-241832584 CACGCACGTCCTGGTGGCGTAGG - Intergenic
1174082761 20:47982884-47982906 CCCGCACATCATGCAGTTGCCGG - Intergenic
1174133195 20:48360098-48360120 CCCGCACATCATGCAGTTGCAGG + Intergenic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
955350145 3:58187709-58187731 CACTCACTTGAGGCTGTCGTTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
973894592 4:55398629-55398651 CACACACATCTTGCTGCCTTGGG + Intronic
996545283 5:124671612-124671634 CAGGCACATCATACTGTCCTGGG + Intronic
996596803 5:125212652-125212674 CAGGCACATCATTCTGTCAATGG - Intergenic
1007764474 6:44152624-44152646 GACGCACATCATCCAGGCGTAGG - Exonic
1018842044 6:167524350-167524372 CAGGCTCTTCATCCTGTCGTTGG - Intergenic
1027640037 7:80722053-80722075 CACCCACAGCCTGCAGTCGTAGG - Intergenic
1035472183 7:159117563-159117585 CACGCAGCTCATGCTCTCTTTGG + Intronic
1044069028 8:87732841-87732863 GACCCAAATCATGCTGTCTTTGG + Intergenic
1051227959 9:14922363-14922385 AATGCACATCAGGCAGTCGTCGG + Intergenic
1058426553 9:104880219-104880241 CAAGCTCATCATGCTGTGATGGG + Intronic
1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG + Intronic