ID: 1065571670

View in Genome Browser
Species Human (GRCh38)
Location 10:27076862-27076884
Sequence GCCAACAAGAAAAAAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065571667_1065571670 18 Left 1065571667 10:27076821-27076843 CCAGTAATAAGCAGTGAGATTGA 0: 2
1: 36
2: 281
3: 528
4: 1081
Right 1065571670 10:27076862-27076884 GCCAACAAGAAAAAAACCCAGGG No data
1065571666_1065571670 28 Left 1065571666 10:27076811-27076833 CCTGAACAGACCAGTAATAAGCA 0: 5
1: 57
2: 466
3: 1217
4: 2230
Right 1065571670 10:27076862-27076884 GCCAACAAGAAAAAAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065571670 Original CRISPR GCCAACAAGAAAAAAACCCA GGG Intronic
No off target data available for this crispr