ID: 1065574155

View in Genome Browser
Species Human (GRCh38)
Location 10:27101503-27101525
Sequence AGAGCTGTCCAGAGCTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065574155_1065574163 4 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG No data
1065574155_1065574161 -3 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574161 10:27101523-27101545 TCTAGGGTCCCTTGTGGAGGAGG No data
1065574155_1065574159 -9 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574159 10:27101517-27101539 GACAGCTCTAGGGTCCCTTGTGG No data
1065574155_1065574166 16 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574166 10:27101542-27101564 GAGGTGGCTGGCCCCAGAACAGG No data
1065574155_1065574162 0 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574162 10:27101526-27101548 AGGGTCCCTTGTGGAGGAGGTGG No data
1065574155_1065574160 -6 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574160 10:27101520-27101542 AGCTCTAGGGTCCCTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065574155 Original CRISPR AGAGCTGTCCAGAGCTATGG AGG (reversed) Intergenic
No off target data available for this crispr