ID: 1065574156

View in Genome Browser
Species Human (GRCh38)
Location 10:27101506-27101528
Sequence CCTAGAGCTGTCCAGAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065574156_1065574166 13 Left 1065574156 10:27101506-27101528 CCATAGCTCTGGACAGCTCTAGG No data
Right 1065574166 10:27101542-27101564 GAGGTGGCTGGCCCCAGAACAGG No data
1065574156_1065574163 1 Left 1065574156 10:27101506-27101528 CCATAGCTCTGGACAGCTCTAGG No data
Right 1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG No data
1065574156_1065574160 -9 Left 1065574156 10:27101506-27101528 CCATAGCTCTGGACAGCTCTAGG No data
Right 1065574160 10:27101520-27101542 AGCTCTAGGGTCCCTTGTGGAGG No data
1065574156_1065574162 -3 Left 1065574156 10:27101506-27101528 CCATAGCTCTGGACAGCTCTAGG No data
Right 1065574162 10:27101526-27101548 AGGGTCCCTTGTGGAGGAGGTGG No data
1065574156_1065574161 -6 Left 1065574156 10:27101506-27101528 CCATAGCTCTGGACAGCTCTAGG No data
Right 1065574161 10:27101523-27101545 TCTAGGGTCCCTTGTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065574156 Original CRISPR CCTAGAGCTGTCCAGAGCTA TGG (reversed) Intergenic
No off target data available for this crispr