ID: 1065574163

View in Genome Browser
Species Human (GRCh38)
Location 10:27101530-27101552
Sequence TCCCTTGTGGAGGAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065574156_1065574163 1 Left 1065574156 10:27101506-27101528 CCATAGCTCTGGACAGCTCTAGG No data
Right 1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG No data
1065574155_1065574163 4 Left 1065574155 10:27101503-27101525 CCTCCATAGCTCTGGACAGCTCT No data
Right 1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065574163 Original CRISPR TCCCTTGTGGAGGAGGTGGC TGG Intergenic
No off target data available for this crispr