ID: 1065574727

View in Genome Browser
Species Human (GRCh38)
Location 10:27105756-27105778
Sequence ACCAGGACCTTGCTTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065574724_1065574727 -5 Left 1065574724 10:27105738-27105760 CCTCCAGCTGGTGCTTTCACCAG No data
Right 1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG No data
1065574722_1065574727 25 Left 1065574722 10:27105708-27105730 CCTATTGTGGAGTGCACAGTTGA No data
Right 1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG No data
1065574726_1065574727 -8 Left 1065574726 10:27105741-27105763 CCAGCTGGTGCTTTCACCAGGAC No data
Right 1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG No data
1065574721_1065574727 26 Left 1065574721 10:27105707-27105729 CCCTATTGTGGAGTGCACAGTTG No data
Right 1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065574727 Original CRISPR ACCAGGACCTTGCTTCTGCC AGG Intergenic
No off target data available for this crispr