ID: 1065577060

View in Genome Browser
Species Human (GRCh38)
Location 10:27131860-27131882
Sequence GTCACCTTTGAACATGTTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065577060_1065577062 -5 Left 1065577060 10:27131860-27131882 CCTTTAACATGTTCAAAGGTGAC 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1065577062 10:27131878-27131900 GTGACATTTTTCATCTGGACAGG 0: 1
1: 0
2: 1
3: 13
4: 139
1065577060_1065577061 -10 Left 1065577060 10:27131860-27131882 CCTTTAACATGTTCAAAGGTGAC 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1065577061 10:27131873-27131895 CAAAGGTGACATTTTTCATCTGG 0: 1
1: 0
2: 1
3: 22
4: 211
1065577060_1065577063 29 Left 1065577060 10:27131860-27131882 CCTTTAACATGTTCAAAGGTGAC 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1065577063 10:27131912-27131934 AATCAAGCCCTGTTGTTGTCCGG 0: 1
1: 0
2: 2
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065577060 Original CRISPR GTCACCTTTGAACATGTTAA AGG (reversed) Exonic