ID: 1065577060

View in Genome Browser
Species Human (GRCh38)
Location 10:27131860-27131882
Sequence GTCACCTTTGAACATGTTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065577060_1065577062 -5 Left 1065577060 10:27131860-27131882 CCTTTAACATGTTCAAAGGTGAC 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1065577062 10:27131878-27131900 GTGACATTTTTCATCTGGACAGG 0: 1
1: 0
2: 1
3: 13
4: 139
1065577060_1065577063 29 Left 1065577060 10:27131860-27131882 CCTTTAACATGTTCAAAGGTGAC 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1065577063 10:27131912-27131934 AATCAAGCCCTGTTGTTGTCCGG 0: 1
1: 0
2: 2
3: 11
4: 135
1065577060_1065577061 -10 Left 1065577060 10:27131860-27131882 CCTTTAACATGTTCAAAGGTGAC 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1065577061 10:27131873-27131895 CAAAGGTGACATTTTTCATCTGG 0: 1
1: 0
2: 1
3: 22
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065577060 Original CRISPR GTCACCTTTGAACATGTTAA AGG (reversed) Exonic
902665088 1:17931773-17931795 CTCACCTTTGAGTATGTTAGAGG + Intergenic
904638615 1:31904189-31904211 GGGCCCTTTGAACAGGTTAAGGG + Intergenic
906400534 1:45501022-45501044 GTCACCTTGGAACTTCCTAAAGG + Intronic
908384007 1:63623266-63623288 GTCCCTTGTGAACAAGTTAAGGG - Exonic
908878359 1:68702987-68703009 TTTGCTTTTGAACATGTTAAGGG - Intergenic
910179075 1:84461921-84461943 GTTACCTTGGAAAATGTTATGGG + Intergenic
911989916 1:104682042-104682064 GTCATCTTTGGACATGTTAGGGG - Intergenic
912007435 1:104921531-104921553 TTCAGCTTTGCACATGTCAAAGG - Intergenic
912672913 1:111648227-111648249 GTGACCTTTGAACTTTTTATTGG + Intronic
913084223 1:115420614-115420636 GATACCTTTCAACAGGTTAATGG - Intergenic
916391440 1:164335160-164335182 GTCATCCTTGAACATTCTAAAGG - Intergenic
916672479 1:167035393-167035415 GTGGACTTTGAACATGGTAAGGG - Intergenic
922535376 1:226376471-226376493 GTCACCCTTGATCATGTGACTGG - Intronic
922709903 1:227819380-227819402 GTCTCCTTTGGTCATGTTACAGG + Intronic
923019647 1:230153403-230153425 GTCAGCCTTCAACATTTTAAGGG + Intronic
923369866 1:233299066-233299088 TTCACATTTGAACATGCTGAGGG - Intergenic
1063122943 10:3117398-3117420 CTCACCTTTGATCATGTCAGAGG + Intronic
1063393476 10:5665643-5665665 GATACCTTTGATCATGTCAAAGG + Intronic
1063698170 10:8357591-8357613 CTCACCTTTGAAAATGTTCCTGG - Intergenic
1065577060 10:27131860-27131882 GTCACCTTTGAACATGTTAAAGG - Exonic
1068816562 10:61321994-61322016 GTGACCTTTGAATATGCAAATGG + Intergenic
1070479374 10:76867283-76867305 TTCTCCTGTGAACAAGTTAACGG + Intergenic
1071731835 10:88255915-88255937 GCCACCTTTGAAGATGTCCAGGG - Intergenic
1072591347 10:96831745-96831767 TTCACCTTTGAAAATCTTAGAGG + Intergenic
1072935687 10:99710929-99710951 GAGACCTTTGAAAATATTAAGGG + Intronic
1073666725 10:105542313-105542335 GTCACCTTCTTACCTGTTAAAGG + Intergenic
1073828411 10:107353962-107353984 GTCACATTTGTACATATTTATGG + Intergenic
1073933650 10:108604382-108604404 GTCTCCTTTGAACATATTTAAGG - Intergenic
1075322247 10:121500821-121500843 CTCACCTTTCAACATCTTCACGG + Exonic
1076194319 10:128504827-128504849 GTAACATTTGAATAAGTTAAGGG - Intergenic
1078948237 11:16096024-16096046 GACACCTTTGAACATGGTGGTGG - Exonic
1080212669 11:29805120-29805142 CTCAACTTTGGACATTTTAATGG - Intergenic
1086075032 11:82841495-82841517 ATTACATTTGAGCATGTTAAAGG - Intronic
1086806898 11:91255108-91255130 GTCACCCTTGGACAAATTAAAGG - Intergenic
1087053506 11:93909254-93909276 GACACCTTTGAAGATGTGGATGG + Intergenic
1087809956 11:102599973-102599995 ATAACCTGTGAACATGTAAAGGG + Intronic
1093566849 12:20616492-20616514 GTCAGCTTTGAAGATGGAAAGGG + Intronic
1094351521 12:29531001-29531023 AGCACCAGTGAACATGTTAAGGG - Intronic
1094407080 12:30127805-30127827 GCCACATTTAAACATGTGAAGGG - Intergenic
1097389427 12:58991725-58991747 GTGACATTTTAACATGATAAAGG - Intergenic
1099366695 12:81773781-81773803 TTCACCTTTGATCATGTTAAGGG + Intergenic
1101267699 12:103107338-103107360 GTCAAATTTGTAAATGTTAACGG - Intergenic
1104226862 12:126843482-126843504 GGCTCCTTTGAACAAGTTAAAGG - Intergenic
1105445713 13:20454770-20454792 GCTACCTTTCATCATGTTAAAGG - Intronic
1105926325 13:25011974-25011996 ATCACCTGGGAACTTGTTAAAGG - Intergenic
1106038666 13:26069002-26069024 ATCACCTGGGAACCTGTTAAAGG + Intergenic
1117911330 14:60641117-60641139 CTCGCCTTTTAACTTGTTAATGG - Intergenic
1120801660 14:88696475-88696497 GTAAACTTTGAAAATGTTTAGGG - Intronic
1125176220 15:36825534-36825556 GGCAGCTTTGCACATTTTAATGG + Intergenic
1128671923 15:69580175-69580197 GTGACCTTTGCCCATGTCAATGG - Intergenic
1129609438 15:77041362-77041384 GTCACGTTTAAACATTTTCATGG - Intergenic
1130220967 15:82019215-82019237 ATTACCTTTGATCATTTTAAAGG - Intergenic
1145362007 17:22220109-22220131 TTCAACTTTGAACATATTGAGGG + Intergenic
1147610026 17:41796375-41796397 GTCATCTTGGAACTTGTGAAGGG + Intergenic
1150738125 17:67757599-67757621 GGCTCCTTTGTAAATGTTAATGG + Intergenic
1151592663 17:75056196-75056218 GCCACCTTTGAACATCAAAAAGG - Intronic
1153641133 18:7158162-7158184 GTCACCTTTTAAAGGGTTAAAGG - Intergenic
1155456508 18:26021146-26021168 GCCACCTTGGAATTTGTTAATGG - Intronic
1155587451 18:27383520-27383542 GTTACTCTTGAAAATGTTAATGG - Intergenic
1157370712 18:47109049-47109071 ATCAGCTGTGAACATGTGAAGGG - Intronic
1160224737 18:77003816-77003838 GTCTCCTTTGAGCATCTTTAAGG - Intronic
1166463398 19:43010333-43010355 GTCACCTTTGCACCTTTTCATGG + Intronic
1166788753 19:45385277-45385299 CTCACCCTTGAAGATGTGAAAGG + Intronic
926863054 2:17328927-17328949 GGCACATATGTACATGTTAATGG + Intergenic
928183108 2:29083737-29083759 GTCTCATGTTAACATGTTAACGG - Intergenic
929229046 2:39540445-39540467 GTCACCATTAAAAATATTAATGG - Intergenic
930342946 2:50140414-50140436 GATACCTTTGGATATGTTAAAGG + Intronic
931010548 2:57907430-57907452 GACAACTTTGCAAATGTTAAGGG - Intergenic
931158570 2:59663304-59663326 TTCACCTTTAAACAGATTAAGGG + Intergenic
933284645 2:80372518-80372540 GACACCAATGAACATGTTCAAGG - Intronic
933839903 2:86278038-86278060 GTCTCCTTTGAACACCTTACTGG + Intronic
935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG + Intergenic
936470895 2:112797800-112797822 GCAACCTGTGAACATGTCAAGGG + Intergenic
941750706 2:169132677-169132699 GTCACCTGTGGACATGTTAAAGG + Exonic
942102400 2:172597726-172597748 GCCACCTTAGAAGATGTTGAGGG - Intronic
942601854 2:177648859-177648881 GTCACCTTTGCAAATAATAAGGG + Intronic
943337241 2:186631442-186631464 TTTACCTTTGAACATTTAAATGG - Intronic
945794157 2:214340896-214340918 GTCACCTTTCTCCATATTAATGG + Intronic
1170351504 20:15446999-15447021 GATACCTCTGCACATGTTAAAGG + Intronic
1170393776 20:15903893-15903915 GTCACTTTTGGACACGTTAAAGG + Intronic
1170411498 20:16096937-16096959 GTGACCTTGGAACATGTCCAAGG - Intergenic
1172637498 20:36419864-36419886 GTCAACCCTGCACATGTTAAGGG + Intronic
1173431654 20:42992912-42992934 GTCACCATGTAACATATTAAAGG - Intronic
1176054685 20:63138168-63138190 GGCACCTGTGAAAATGTAAATGG + Intergenic
949147444 3:719576-719598 TTCCCCTTTAAACATGTCAAAGG + Intergenic
949492066 3:4598667-4598689 GCCACTTATGAACATCTTAAAGG - Intronic
949731851 3:7123067-7123089 TTCATCTTTGAACATGTCAGTGG + Intronic
951461654 3:22957652-22957674 GTCACGCTTGTTCATGTTAAAGG + Intergenic
951974439 3:28488370-28488392 CTCACCTTTGTACATGTTGTTGG + Intronic
955194648 3:56794037-56794059 GTCACATTTGGAAAAGTTAAGGG + Intronic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
962263835 3:133931687-133931709 CTCACCTTTGAACATACCAAAGG + Intergenic
962415275 3:135176400-135176422 GTCAATTTAGAACATCTTAATGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964410841 3:156396171-156396193 GTCACCTTTGATCATCCTAATGG + Intronic
967083752 3:186075073-186075095 GTTACCTTTTAACAAGCTAAAGG - Intronic
967354845 3:188557181-188557203 GGCACGTCTGAAGATGTTAAAGG - Intronic
970733179 4:19133122-19133144 GTCATCTTTGAGCATGATAAAGG - Intergenic
976152109 4:82102717-82102739 GTCTCCATTGAACATGTTGAGGG + Intergenic
976223888 4:82780228-82780250 GTTACCTTTGAATAGGTGAATGG - Intronic
977424733 4:96853326-96853348 GTAACCTTTTAACATGTATATGG - Intergenic
980008897 4:127573983-127574005 ATCACCTTGGAAAATTTTAATGG - Intergenic
980203781 4:129691267-129691289 CTCACCTTGGTTCATGTTAATGG + Intergenic
980298409 4:130955476-130955498 GTCATATTTGAATATTTTAAAGG + Intergenic
980718585 4:136661618-136661640 GTCAGCTGTGAACATGTTTTTGG + Intergenic
981984819 4:150841263-150841285 GTAAACATTGAACATATTAATGG - Intronic
985264850 4:188148018-188148040 GTCACCTTTTAACATATTAATGG - Intergenic
987219976 5:15781180-15781202 GTCATGCTTGAATATGTTAAGGG + Intronic
988531248 5:32029218-32029240 GTCATCTTTCTAAATGTTAAGGG - Intronic
990747240 5:58971281-58971303 GTCACCTTAGAGCTTGTTTATGG - Exonic
990972459 5:61523888-61523910 GTCACATATAAACATGTGAAAGG + Intronic
994435438 5:99724838-99724860 GTCATCTTTGACAGTGTTAAAGG - Intergenic
994876589 5:105430925-105430947 GTAACGGTTGAATATGTTAAGGG - Intergenic
1001047967 5:168389975-168389997 GTTTCCTTAGAACATATTAATGG + Intronic
1002133228 5:177093758-177093780 CTCACCTTTGAGCATCTTGACGG - Exonic
1004813120 6:19281677-19281699 TTCTCCTTTGAAAATGTAAAAGG - Intergenic
1008434309 6:51457085-51457107 GTCACCAATGCCCATGTTAAGGG + Intergenic
1009027801 6:58021292-58021314 GACACCTTTAAACATTTTGAGGG - Intergenic
1013354652 6:109336189-109336211 GTCAGCTTTGAACATTTGTAAGG - Intergenic
1013650463 6:112189396-112189418 GTCACCTTTGAAAATCTCATTGG - Intronic
1017788229 6:157773875-157773897 GTCGCCTGTGCACGTGTTAAAGG + Intronic
1021984472 7:26085527-26085549 GTCCACTTTTAAAATGTTAAGGG + Intergenic
1022013374 7:26328488-26328510 GACACCTTTGTACATGATATGGG + Intronic
1022936171 7:35180429-35180451 ATGACATTTGAACATTTTAAAGG - Intergenic
1024034713 7:45497553-45497575 CTCCCCTTTCAACATGTTCAGGG - Intergenic
1029832138 7:103273141-103273163 ATGACATTTGAACATTTTAAAGG - Intergenic
1030217025 7:107054604-107054626 GTCAACTTTGCAGATGTCAAGGG + Intronic
1032557559 7:132853295-132853317 GTCACCTTTTGACATATAAAAGG + Intronic
1034061982 7:148100315-148100337 GTCACCTTTGTGGATGGTAATGG - Intronic
1037831928 8:22194902-22194924 GGCACCTTTGAAAAAGTTGACGG - Exonic
1045074795 8:98552380-98552402 ATCACATTTGGACATGATAAAGG - Intronic
1047110934 8:121788617-121788639 GTCTCCTTTGAAATTGTTTAAGG - Intergenic
1050462435 9:5887951-5887973 GTCACCACTGAAAATGGTAAGGG - Intronic
1051688594 9:19684576-19684598 GTGACCCTTGAACATTTTAAGGG + Intronic
1052017443 9:23485502-23485524 ATTATCTTTGAAAATGTTAAAGG - Intergenic
1052527260 9:29634236-29634258 TTCACCTTTCACAATGTTAATGG + Intergenic
1056498367 9:87183671-87183693 GTCACCTTTGAAGATGACAGAGG + Intergenic
1056934965 9:90909476-90909498 GTTACTTTTGAACACTTTAACGG + Intergenic
1057296306 9:93845063-93845085 GTCTCCTTTGATCAAGTTACAGG + Intergenic
1060714653 9:125912851-125912873 GGCACCTATAAACATTTTAATGG - Intronic
1061038552 9:128126876-128126898 GTCTCCTTAAAACATGGTAAAGG + Intronic
1062236184 9:135508944-135508966 GTCTCCTCTGAACATGTGTAAGG - Intergenic
1188914464 X:35892484-35892506 TTGACCTCTGAACATGTTCAAGG - Intergenic
1193459086 X:81768790-81768812 ATCACCTGTGAACATATTAGTGG + Intergenic
1194050304 X:89059876-89059898 GTCACCTCTGAATATTTTATGGG + Intergenic
1195707359 X:107747512-107747534 GCCACATTTGAACTTTTTAATGG - Intronic
1197928813 X:131675163-131675185 GTCATGATGGAACATGTTAAGGG + Intergenic
1199137532 X:144270748-144270770 GTCTCTTTTGGACATGTCAAAGG + Intergenic