ID: 1065581505

View in Genome Browser
Species Human (GRCh38)
Location 10:27176159-27176181
Sequence CCTCAGTTTCATCACCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065581499_1065581505 4 Left 1065581499 10:27176132-27176154 CCCAGCTAGCTCTTCCTCTGTTC 0: 1
1: 0
2: 2
3: 17
4: 246
Right 1065581505 10:27176159-27176181 CCTCAGTTTCATCACCTTCATGG No data
1065581501_1065581505 -10 Left 1065581501 10:27176146-27176168 CCTCTGTTCCCTACCTCAGTTTC 0: 1
1: 1
2: 2
3: 35
4: 510
Right 1065581505 10:27176159-27176181 CCTCAGTTTCATCACCTTCATGG No data
1065581500_1065581505 3 Left 1065581500 10:27176133-27176155 CCAGCTAGCTCTTCCTCTGTTCC 0: 1
1: 0
2: 1
3: 24
4: 318
Right 1065581505 10:27176159-27176181 CCTCAGTTTCATCACCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065581505 Original CRISPR CCTCAGTTTCATCACCTTCA TGG Intronic
No off target data available for this crispr