ID: 1065588257

View in Genome Browser
Species Human (GRCh38)
Location 10:27240906-27240928
Sequence GACCGCGCGCGTCCTTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065588257_1065588267 9 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588267 10:27240938-27240960 CCAGAGGAGGGTCCGGGAAGCGG 0: 1
1: 0
2: 2
3: 39
4: 357
1065588257_1065588273 19 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588273 10:27240948-27240970 GTCCGGGAAGCGGGGAAAGGGGG 0: 1
1: 0
2: 0
3: 26
4: 292
1065588257_1065588258 -7 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588258 10:27240922-27240944 CGCGGTCCGTCTGTCCCCAGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1065588257_1065588271 17 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588271 10:27240946-27240968 GGGTCCGGGAAGCGGGGAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 282
1065588257_1065588260 -3 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588260 10:27240926-27240948 GTCCGTCTGTCCCCAGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 175
1065588257_1065588263 3 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588263 10:27240932-27240954 CTGTCCCCAGAGGAGGGTCCGGG 0: 1
1: 0
2: 3
3: 53
4: 354
1065588257_1065588269 11 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588269 10:27240940-27240962 AGAGGAGGGTCCGGGAAGCGGGG 0: 1
1: 0
2: 1
3: 32
4: 383
1065588257_1065588262 2 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588262 10:27240931-27240953 TCTGTCCCCAGAGGAGGGTCCGG 0: 1
1: 0
2: 2
3: 40
4: 275
1065588257_1065588268 10 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588268 10:27240939-27240961 CAGAGGAGGGTCCGGGAAGCGGG 0: 1
1: 0
2: 5
3: 34
4: 351
1065588257_1065588259 -4 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588259 10:27240925-27240947 GGTCCGTCTGTCCCCAGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 159
1065588257_1065588270 16 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588270 10:27240945-27240967 AGGGTCCGGGAAGCGGGGAAAGG 0: 1
1: 0
2: 3
3: 19
4: 324
1065588257_1065588272 18 Left 1065588257 10:27240906-27240928 CCGCGGCAAGGACGCGCGCGGTC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1065588272 10:27240947-27240969 GGTCCGGGAAGCGGGGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065588257 Original CRISPR GACCGCGCGCGTCCTTGCCG CGG (reversed) Intronic
900237739 1:1600557-1600579 GACTGCGCGGGTCCCCGCCGCGG - Intergenic
904511107 1:31008883-31008905 CACCGCGCCCGGCCTTGCAGGGG - Intronic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
1065588257 10:27240906-27240928 GACCGCGCGCGTCCTTGCCGCGG - Intronic
1069818304 10:71212500-71212522 GACCGCGCGCGGCCGGGGCGGGG - Intergenic
1077086605 11:755531-755553 GACCGCGCGCCTCCTTGTGGTGG + Intronic
1083812294 11:65112599-65112621 GTCCACCCGCGTCCCTGCCGGGG + Exonic
1084758343 11:71252638-71252660 GGCCGCACGCGTCCTTTCGGCGG - Intergenic
1089845098 11:121452229-121452251 GACCGCGCGCGCCGCTCCCGGGG - Exonic
1090803704 11:130189802-130189824 GGCCGAGCGCGTCATGGCCGAGG + Exonic
1101813673 12:108129486-108129508 GCCCGCGCGGGGCCTCGCCGCGG + Intronic
1103621809 12:122191546-122191568 GTCCGCGGGCGTCCTGGCCGAGG + Exonic
1123048304 14:105528798-105528820 GGCCGCGCGCGCCCAGGCCGGGG + Exonic
1124500332 15:30222987-30223009 CCCCGCGCGCGTCCATGGCGAGG - Intergenic
1124743241 15:32315679-32315701 CCCCGCGCGCGTCCATGGCGAGG + Intergenic
1131692843 15:94845180-94845202 GGCCGCGCGTGTCGCTGCCGCGG - Intergenic
1132724589 16:1333376-1333398 GGCCGCGCGCGCCCTCCCCGTGG - Intergenic
1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG + Intergenic
1146646844 17:34581659-34581681 GACCGCGGGCGTGCGAGCCGCGG - Intronic
1151724821 17:75877808-75877830 GACCGCGCGCGAGCGGGCCGAGG - Intronic
1160719141 19:589939-589961 CCCCGCGCGCGTCCATGGCGAGG - Exonic
1160788216 19:911799-911821 GAGCCCGCGCGTCCTTCCCGGGG - Intronic
1161925111 19:7294058-7294080 AGCCGCGCGCGCCCTTCCCGGGG - Intergenic
1167440793 19:49507685-49507707 CACCGCGCCCGGCCTTGCCAGGG + Intronic
1168685501 19:58347119-58347141 GACCACGCGCTTCCTTCCGGGGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
936439954 2:112542683-112542705 GTCCGCCGGCGCCCTTGCCGCGG + Intronic
948046606 2:234950994-234951016 GAAAGCGCGGGTCTTTGCCGGGG - Intergenic
1174255103 20:49248684-49248706 GACTGCGGGCATCCTTGCCCAGG - Exonic
971019105 4:22516193-22516215 GAGCGCGCGCCTCCTCCCCGAGG - Intergenic
977894216 4:102345575-102345597 TCCCGCGCGCGTCCACGCCGGGG + Intronic
980130039 4:128809869-128809891 GCCCGCGCGCGTACCTGCTGCGG - Exonic
987088107 5:14487924-14487946 TAGCGCGCGCGTCCTTGGCGGGG - Exonic
1034911626 7:155002825-155002847 TACCGCGCCCGCCCCTGCCGCGG - Intronic
1035496836 7:159335339-159335361 GACCGCCCGCGTCTGTGCTGAGG - Intergenic
1042244518 8:66697314-66697336 CACCGCGCCCGGCCTTGCAGGGG - Intronic
1051418816 9:16870817-16870839 GCCCGCGCGCGCCCTCGCCGCGG + Intronic
1059521736 9:114948970-114948992 GTCCTCCTGCGTCCTTGCCGCGG + Intergenic
1062394807 9:136348471-136348493 GACAGAGCGCGTCCTGGCTGGGG - Intronic
1185758431 X:2670859-2670881 CACCGTGCCCGTCCTTGCCTTGG + Intergenic
1186463327 X:9765550-9765572 GGCCGCGCGCGCCCTTACCCAGG + Exonic
1186849843 X:13569673-13569695 GGCCGCGAGCGCCCCTGCCGCGG + Exonic