ID: 1065588550

View in Genome Browser
Species Human (GRCh38)
Location 10:27242307-27242329
Sequence CAATCTCAAGACACTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065588550_1065588554 20 Left 1065588550 10:27242307-27242329 CCAGCTTAAGTGTCTTGAGATTG No data
Right 1065588554 10:27242350-27242372 GCTTCTCCAGCGCCCTCCGGAGG No data
1065588550_1065588552 -2 Left 1065588550 10:27242307-27242329 CCAGCTTAAGTGTCTTGAGATTG No data
Right 1065588552 10:27242328-27242350 TGTCGCGGTGTCTGCAGCTGCGG No data
1065588550_1065588553 17 Left 1065588550 10:27242307-27242329 CCAGCTTAAGTGTCTTGAGATTG No data
Right 1065588553 10:27242347-27242369 GCGGCTTCTCCAGCGCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065588550 Original CRISPR CAATCTCAAGACACTTAAGC TGG (reversed) Intergenic
No off target data available for this crispr