ID: 1065599102

View in Genome Browser
Species Human (GRCh38)
Location 10:27350264-27350286
Sequence GCCCAGCCCCGCCAGCAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 303}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065599098_1065599102 -10 Left 1065599098 10:27350251-27350273 CCCTGCCTGCCGGGCCCAGCCCC 0: 1
1: 2
2: 5
3: 82
4: 855
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599093_1065599102 1 Left 1065599093 10:27350240-27350262 CCAGGCGCCCACCCTGCCTGCCG No data
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599091_1065599102 7 Left 1065599091 10:27350234-27350256 CCGGACCCAGGCGCCCACCCTGC 0: 1
1: 1
2: 4
3: 50
4: 613
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599097_1065599102 -7 Left 1065599097 10:27350248-27350270 CCACCCTGCCTGCCGGGCCCAGC 0: 1
1: 2
2: 8
3: 98
4: 738
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599087_1065599102 29 Left 1065599087 10:27350212-27350234 CCAGGAGCCATGTGGCGCAAGGC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599085_1065599102 30 Left 1065599085 10:27350211-27350233 CCCAGGAGCCATGTGGCGCAAGG 0: 1
1: 0
2: 6
3: 20
4: 146
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599092_1065599102 2 Left 1065599092 10:27350239-27350261 CCCAGGCGCCCACCCTGCCTGCC 0: 1
1: 1
2: 2
3: 68
4: 613
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599089_1065599102 22 Left 1065599089 10:27350219-27350241 CCATGTGGCGCAAGGCCGGACCC 0: 1
1: 0
2: 1
3: 6
4: 49
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303
1065599096_1065599102 -6 Left 1065599096 10:27350247-27350269 CCCACCCTGCCTGCCGGGCCCAG 0: 1
1: 1
2: 12
3: 59
4: 542
Right 1065599102 10:27350264-27350286 GCCCAGCCCCGCCAGCAACACGG 0: 1
1: 0
2: 3
3: 30
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065599102 Original CRISPR GCCCAGCCCCGCCAGCAACA CGG Intergenic