ID: 1065600830

View in Genome Browser
Species Human (GRCh38)
Location 10:27366873-27366895
Sequence CAGTGTGGGCCCTGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065600823_1065600830 8 Left 1065600823 10:27366842-27366864 CCAAAGTGGAGGATAAATTTGCC No data
Right 1065600830 10:27366873-27366895 CAGTGTGGGCCCTGGGAAATAGG No data
1065600822_1065600830 15 Left 1065600822 10:27366835-27366857 CCTTGGACCAAAGTGGAGGATAA No data
Right 1065600830 10:27366873-27366895 CAGTGTGGGCCCTGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065600830 Original CRISPR CAGTGTGGGCCCTGGGAAAT AGG Intergenic
No off target data available for this crispr