ID: 1065601408

View in Genome Browser
Species Human (GRCh38)
Location 10:27372832-27372854
Sequence ATTTAGAAAATGTCTGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065601405_1065601408 20 Left 1065601405 10:27372789-27372811 CCAAAGTGAGTATGATTGAATTA No data
Right 1065601408 10:27372832-27372854 ATTTAGAAAATGTCTGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065601408 Original CRISPR ATTTAGAAAATGTCTGATTA AGG Intergenic
No off target data available for this crispr