ID: 1065603230

View in Genome Browser
Species Human (GRCh38)
Location 10:27391142-27391164
Sequence GCAAACTCCCTCTCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065603228_1065603230 -9 Left 1065603228 10:27391128-27391150 CCTGAGCTATTCCGGCAAACTCC No data
Right 1065603230 10:27391142-27391164 GCAAACTCCCTCTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065603230 Original CRISPR GCAAACTCCCTCTCATCTCA AGG Intergenic
No off target data available for this crispr