ID: 1065603570

View in Genome Browser
Species Human (GRCh38)
Location 10:27393496-27393518
Sequence GAGTCAGAGGGCCCCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065603565_1065603570 4 Left 1065603565 10:27393469-27393491 CCAAAGGGAAGCATTGCCTCCAG No data
Right 1065603570 10:27393496-27393518 GAGTCAGAGGGCCCCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065603570 Original CRISPR GAGTCAGAGGGCCCCCTGTC TGG Intergenic
No off target data available for this crispr