ID: 1065603601

View in Genome Browser
Species Human (GRCh38)
Location 10:27393709-27393731
Sequence CCACCTGACTAGGGTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065603601_1065603609 -2 Left 1065603601 10:27393709-27393731 CCCATATTACCCTAGTCAGGTGG No data
Right 1065603609 10:27393730-27393752 GGGGGTACCACCCCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065603601 Original CRISPR CCACCTGACTAGGGTAATAT GGG (reversed) Intergenic
No off target data available for this crispr