ID: 1065605816

View in Genome Browser
Species Human (GRCh38)
Location 10:27416401-27416423
Sequence CCTGGGTTCCTGAAGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065605810_1065605816 11 Left 1065605810 10:27416367-27416389 CCTACTTGAACTGTGGTACATAA No data
Right 1065605816 10:27416401-27416423 CCTGGGTTCCTGAAGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065605816 Original CRISPR CCTGGGTTCCTGAAGCATCA TGG Intergenic
No off target data available for this crispr