ID: 1065607016

View in Genome Browser
Species Human (GRCh38)
Location 10:27428505-27428527
Sequence AGTTATCCACTGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065607016_1065607023 16 Left 1065607016 10:27428505-27428527 CCTGCCATCCTCAGTGGATAACT No data
Right 1065607023 10:27428544-27428566 ACAGCTTTTGTCTATCTACTGGG No data
1065607016_1065607022 15 Left 1065607016 10:27428505-27428527 CCTGCCATCCTCAGTGGATAACT No data
Right 1065607022 10:27428543-27428565 AACAGCTTTTGTCTATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065607016 Original CRISPR AGTTATCCACTGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr