ID: 1065607384

View in Genome Browser
Species Human (GRCh38)
Location 10:27432160-27432182
Sequence CTTTATATGGAGATTATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065607381_1065607384 18 Left 1065607381 10:27432119-27432141 CCGAATCCAGCAGCACATCAGAA 0: 92
1: 6924
2: 3373
3: 1874
4: 1727
Right 1065607384 10:27432160-27432182 CTTTATATGGAGATTATGTATGG No data
1065607382_1065607384 12 Left 1065607382 10:27432125-27432147 CCAGCAGCACATCAGAATTAAAA No data
Right 1065607384 10:27432160-27432182 CTTTATATGGAGATTATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065607384 Original CRISPR CTTTATATGGAGATTATGTA TGG Intergenic
No off target data available for this crispr