ID: 1065613937

View in Genome Browser
Species Human (GRCh38)
Location 10:27500958-27500980
Sequence TCGGAACCTCAGCTCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065613934_1065613937 -1 Left 1065613934 10:27500936-27500958 CCTGGAGAGGGTGGGGGTTGTTT No data
Right 1065613937 10:27500958-27500980 TCGGAACCTCAGCTCAGCCAGGG No data
1065613926_1065613937 20 Left 1065613926 10:27500915-27500937 CCGAGGCAAGGAGAAGCAGTACC No data
Right 1065613937 10:27500958-27500980 TCGGAACCTCAGCTCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065613937 Original CRISPR TCGGAACCTCAGCTCAGCCA GGG Intergenic