ID: 1065614387

View in Genome Browser
Species Human (GRCh38)
Location 10:27504785-27504807
Sequence GCCTTGCCTCGAACCTCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065614382_1065614387 -5 Left 1065614382 10:27504767-27504789 CCGAATCCGGCCGGGGGCGCCTT 0: 1
1: 1
2: 0
3: 1
4: 27
Right 1065614387 10:27504785-27504807 GCCTTGCCTCGAACCTCTCGGGG No data
1065614381_1065614387 -4 Left 1065614381 10:27504766-27504788 CCCGAATCCGGCCGGGGGCGCCT 0: 2
1: 0
2: 0
3: 1
4: 49
Right 1065614387 10:27504785-27504807 GCCTTGCCTCGAACCTCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065614387 Original CRISPR GCCTTGCCTCGAACCTCTCG GGG Intronic
No off target data available for this crispr