ID: 1065618915

View in Genome Browser
Species Human (GRCh38)
Location 10:27558722-27558744
Sequence CAGTAACATGAGAGACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065618913_1065618915 -1 Left 1065618913 10:27558700-27558722 CCATGAGGTGGCAGCAGCTCCTC No data
Right 1065618915 10:27558722-27558744 CAGTAACATGAGAGACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065618915 Original CRISPR CAGTAACATGAGAGACCCTG TGG Intergenic
No off target data available for this crispr