ID: 1065622537

View in Genome Browser
Species Human (GRCh38)
Location 10:27598430-27598452
Sequence CCAATTTGATAGTGTCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622533_1065622537 24 Left 1065622533 10:27598383-27598405 CCCATTTCTGTCTCTCTCTTCTT No data
Right 1065622537 10:27598430-27598452 CCAATTTGATAGTGTCTCATAGG No data
1065622534_1065622537 23 Left 1065622534 10:27598384-27598406 CCATTTCTGTCTCTCTCTTCTTG No data
Right 1065622537 10:27598430-27598452 CCAATTTGATAGTGTCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622537 Original CRISPR CCAATTTGATAGTGTCTCAT AGG Intergenic
No off target data available for this crispr