ID: 1065622729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:27599909-27599931 |
| Sequence | GGTTTTTCGATCCAGGTAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065622729_1065622740 | 30 | Left | 1065622729 | 10:27599909-27599931 | CCTCCTACCTGGATCGAAAAACC | No data | ||
| Right | 1065622740 | 10:27599962-27599984 | AGCCAAAATATTGTTACTGTCGG | No data | ||||
| 1065622729_1065622738 | 2 | Left | 1065622729 | 10:27599909-27599931 | CCTCCTACCTGGATCGAAAAACC | No data | ||
| Right | 1065622738 | 10:27599934-27599956 | CACAAGGGCACTTTTGTCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065622729 | Original CRISPR | GGTTTTTCGATCCAGGTAGG AGG (reversed) | Intergenic | ||