ID: 1065622730

View in Genome Browser
Species Human (GRCh38)
Location 10:27599912-27599934
Sequence GGGGGTTTTTCGATCCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622730_1065622738 -1 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622738 10:27599934-27599956 CACAAGGGCACTTTTGTCCATGG No data
1065622730_1065622744 30 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622730_1065622741 28 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622730_1065622740 27 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622740 10:27599962-27599984 AGCCAAAATATTGTTACTGTCGG No data
1065622730_1065622743 29 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622743 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622730 Original CRISPR GGGGGTTTTTCGATCCAGGT AGG (reversed) Intergenic