ID: 1065622731

View in Genome Browser
Species Human (GRCh38)
Location 10:27599916-27599938
Sequence TTGTGGGGGTTTTTCGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622731_1065622740 23 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622740 10:27599962-27599984 AGCCAAAATATTGTTACTGTCGG No data
1065622731_1065622744 26 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622731_1065622741 24 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622731_1065622738 -5 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622738 10:27599934-27599956 CACAAGGGCACTTTTGTCCATGG No data
1065622731_1065622743 25 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622743 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622731 Original CRISPR TTGTGGGGGTTTTTCGATCC AGG (reversed) Intergenic
No off target data available for this crispr