ID: 1065622735

View in Genome Browser
Species Human (GRCh38)
Location 10:27599931-27599953
Sequence TGGACAAAAGTGCCCTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622735_1065622747 25 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622735_1065622741 9 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622735_1065622743 10 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622743 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data
1065622735_1065622745 21 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622735_1065622740 8 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622740 10:27599962-27599984 AGCCAAAATATTGTTACTGTCGG No data
1065622735_1065622744 11 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622735_1065622746 24 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622746 10:27599978-27600000 CTGTCGGGGGCTCCCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622735 Original CRISPR TGGACAAAAGTGCCCTTGTG GGG (reversed) Intergenic
No off target data available for this crispr