ID: 1065622737

View in Genome Browser
Species Human (GRCh38)
Location 10:27599933-27599955
Sequence CATGGACAAAAGTGCCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622737_1065622747 23 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622737_1065622745 19 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622737_1065622741 7 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622737_1065622743 8 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622743 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data
1065622737_1065622744 9 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622737_1065622740 6 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622740 10:27599962-27599984 AGCCAAAATATTGTTACTGTCGG No data
1065622737_1065622746 22 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622746 10:27599978-27600000 CTGTCGGGGGCTCCCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622737 Original CRISPR CATGGACAAAAGTGCCCTTG TGG (reversed) Intergenic