ID: 1065622739

View in Genome Browser
Species Human (GRCh38)
Location 10:27599951-27599973
Sequence AATATTTTGGCTGCTATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622739_1065622744 -9 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622739_1065622745 1 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622739_1065622746 4 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622746 10:27599978-27600000 CTGTCGGGGGCTCCCAATGGCGG No data
1065622739_1065622743 -10 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622743 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data
1065622739_1065622747 5 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622739 Original CRISPR AATATTTTGGCTGCTATCCA TGG (reversed) Intergenic
No off target data available for this crispr