ID: 1065622741

View in Genome Browser
Species Human (GRCh38)
Location 10:27599963-27599985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622736_1065622741 8 Left 1065622736 10:27599932-27599954 CCCACAAGGGCACTTTTGTCCAT No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622737_1065622741 7 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622734_1065622741 10 Left 1065622734 10:27599930-27599952 CCCCCACAAGGGCACTTTTGTCC No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622731_1065622741 24 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622730_1065622741 28 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data
1065622735_1065622741 9 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622741 10:27599963-27599985 GCCAAAATATTGTTACTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622741 Original CRISPR GCCAAAATATTGTTACTGTC GGG Intergenic