ID: 1065622742

View in Genome Browser
Species Human (GRCh38)
Location 10:27599964-27599986
Sequence CCCCGACAGTAACAATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622742_1065622747 -8 Left 1065622742 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622742_1065622746 -9 Left 1065622742 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data
Right 1065622746 10:27599978-27600000 CTGTCGGGGGCTCCCAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622742 Original CRISPR CCCCGACAGTAACAATATTT TGG (reversed) Intergenic
No off target data available for this crispr