ID: 1065622744

View in Genome Browser
Species Human (GRCh38)
Location 10:27599965-27599987
Sequence CAAAATATTGTTACTGTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622730_1065622744 30 Left 1065622730 10:27599912-27599934 CCTACCTGGATCGAAAAACCCCC No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622737_1065622744 9 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622734_1065622744 12 Left 1065622734 10:27599930-27599952 CCCCCACAAGGGCACTTTTGTCC No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622736_1065622744 10 Left 1065622736 10:27599932-27599954 CCCACAAGGGCACTTTTGTCCAT No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622731_1065622744 26 Left 1065622731 10:27599916-27599938 CCTGGATCGAAAAACCCCCACAA No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622739_1065622744 -9 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data
1065622735_1065622744 11 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622744 10:27599965-27599987 CAAAATATTGTTACTGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622744 Original CRISPR CAAAATATTGTTACTGTCGG GGG Intergenic
No off target data available for this crispr