ID: 1065622745

View in Genome Browser
Species Human (GRCh38)
Location 10:27599975-27599997
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622736_1065622745 20 Left 1065622736 10:27599932-27599954 CCCACAAGGGCACTTTTGTCCAT No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622737_1065622745 19 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622734_1065622745 22 Left 1065622734 10:27599930-27599952 CCCCCACAAGGGCACTTTTGTCC No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622739_1065622745 1 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data
1065622735_1065622745 21 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622745 10:27599975-27599997 TTACTGTCGGGGGCTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622745 Original CRISPR TTACTGTCGGGGGCTCCCAA TGG Intergenic