ID: 1065622747

View in Genome Browser
Species Human (GRCh38)
Location 10:27599979-27600001
Sequence TGTCGGGGGCTCCCAATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065622739_1065622747 5 Left 1065622739 10:27599951-27599973 CCATGGATAGCAGCCAAAATATT No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622736_1065622747 24 Left 1065622736 10:27599932-27599954 CCCACAAGGGCACTTTTGTCCAT No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622742_1065622747 -8 Left 1065622742 10:27599964-27599986 CCAAAATATTGTTACTGTCGGGG No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622735_1065622747 25 Left 1065622735 10:27599931-27599953 CCCCACAAGGGCACTTTTGTCCA No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622734_1065622747 26 Left 1065622734 10:27599930-27599952 CCCCCACAAGGGCACTTTTGTCC No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data
1065622737_1065622747 23 Left 1065622737 10:27599933-27599955 CCACAAGGGCACTTTTGTCCATG No data
Right 1065622747 10:27599979-27600001 TGTCGGGGGCTCCCAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065622747 Original CRISPR TGTCGGGGGCTCCCAATGGC GGG Intergenic
No off target data available for this crispr