ID: 1065623250

View in Genome Browser
Species Human (GRCh38)
Location 10:27605491-27605513
Sequence AGTGTGGGTGGCCCCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065623250_1065623255 -1 Left 1065623250 10:27605491-27605513 CCCTCTCTGGGGCCACCCACACT No data
Right 1065623255 10:27605513-27605535 TATCCTGCTTATGTACTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065623250 Original CRISPR AGTGTGGGTGGCCCCAGAGA GGG (reversed) Intergenic