ID: 1065626515

View in Genome Browser
Species Human (GRCh38)
Location 10:27635034-27635056
Sequence CATTTTTAGCAGCCTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065626510_1065626515 5 Left 1065626510 10:27635006-27635028 CCCATACTGCTGTGTCACTACTT No data
Right 1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG No data
1065626506_1065626515 23 Left 1065626506 10:27634988-27635010 CCTGGATCCTTCCTTGACCCCAT No data
Right 1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG No data
1065626507_1065626515 16 Left 1065626507 10:27634995-27635017 CCTTCCTTGACCCCATACTGCTG No data
Right 1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG No data
1065626511_1065626515 4 Left 1065626511 10:27635007-27635029 CCATACTGCTGTGTCACTACTTC No data
Right 1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG No data
1065626509_1065626515 6 Left 1065626509 10:27635005-27635027 CCCCATACTGCTGTGTCACTACT No data
Right 1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG No data
1065626508_1065626515 12 Left 1065626508 10:27634999-27635021 CCTTGACCCCATACTGCTGTGTC No data
Right 1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065626515 Original CRISPR CATTTTTAGCAGCCTGAACT TGG Intergenic
No off target data available for this crispr