ID: 1065630177

View in Genome Browser
Species Human (GRCh38)
Location 10:27671786-27671808
Sequence CCTTGGAAGGCGGTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065630177_1065630186 15 Left 1065630177 10:27671786-27671808 CCACAACACACCGCCTTCCAAGG No data
Right 1065630186 10:27671824-27671846 CCATCCCTGGCAGGACAGCATGG No data
1065630177_1065630187 16 Left 1065630177 10:27671786-27671808 CCACAACACACCGCCTTCCAAGG No data
Right 1065630187 10:27671825-27671847 CATCCCTGGCAGGACAGCATGGG No data
1065630177_1065630183 6 Left 1065630177 10:27671786-27671808 CCACAACACACCGCCTTCCAAGG No data
Right 1065630183 10:27671815-27671837 TTTCCTATGCCATCCCTGGCAGG No data
1065630177_1065630189 19 Left 1065630177 10:27671786-27671808 CCACAACACACCGCCTTCCAAGG No data
Right 1065630189 10:27671828-27671850 CCCTGGCAGGACAGCATGGGTGG No data
1065630177_1065630182 2 Left 1065630177 10:27671786-27671808 CCACAACACACCGCCTTCCAAGG No data
Right 1065630182 10:27671811-27671833 TGACTTTCCTATGCCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065630177 Original CRISPR CCTTGGAAGGCGGTGTGTTG TGG (reversed) Intergenic
No off target data available for this crispr