ID: 1065632982

View in Genome Browser
Species Human (GRCh38)
Location 10:27700188-27700210
Sequence GATGATTTACTAACAAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065632981_1065632982 -8 Left 1065632981 10:27700173-27700195 CCTTTATGGATTTTAGATGATTT 0: 1
1: 0
2: 4
3: 23
4: 372
Right 1065632982 10:27700188-27700210 GATGATTTACTAACAAAGTATGG No data
1065632980_1065632982 -2 Left 1065632980 10:27700167-27700189 CCATGACCTTTATGGATTTTAGA 0: 1
1: 0
2: 1
3: 20
4: 248
Right 1065632982 10:27700188-27700210 GATGATTTACTAACAAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065632982 Original CRISPR GATGATTTACTAACAAAGTA TGG Intronic
No off target data available for this crispr