ID: 1065633187

View in Genome Browser
Species Human (GRCh38)
Location 10:27703174-27703196
Sequence CATTCTCTGTAGGAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065633183_1065633187 0 Left 1065633183 10:27703151-27703173 CCTAAAAGAGTGCCATAGAAGAG 0: 1
1: 0
2: 1
3: 6
4: 227
Right 1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG No data
1065633182_1065633187 14 Left 1065633182 10:27703137-27703159 CCAGTTTTTTAATTCCTAAAAGA 0: 1
1: 1
2: 6
3: 52
4: 510
Right 1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG No data
1065633181_1065633187 28 Left 1065633181 10:27703123-27703145 CCACAAAGGGAAGTCCAGTTTTT 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065633187 Original CRISPR CATTCTCTGTAGGAGGAAAA AGG Intronic
No off target data available for this crispr